S1-RNase, HQ689388.1-S1-RNase (gene) Malus x domestica

Gene Overview
Unique NameHQ689388.1-S1-RNase
OrganismMalus x domestica (Apple)
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S1-RNaseS1-RNaseMalus x domesticagene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
S1-RNaseHQ689388.1-S1-RNase.m1Malus x domesticamRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
HQ689388 region HQ689388:1..540+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>HQ689388.1-S1-RNase ID=HQ689388.1-S1-RNase|Name=S1-RNase|organism=Malus x domestica|type=gene|length=540bp
back to top

gene from alignment at HQ689388:1..540+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ689388.1-S1-RNase ID=HQ689388.1-S1-RNase|Name=S1-RNase|organism=Malus x domestica|type=gene|length=540bp|location=Sequence derived from alignment at HQ689388:1..540+ (Malus x domestica)
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactcctt gtaaggatcctcctgacaagttgtttaccgttcacggtttgtggccttca aactcgaatggaaatgacccagaatattgtaaggcaccgccatatcatac ggtaatattattagcataatcagatagtcaatattatttctctcatttat gtacttgtgtgtgtgtatatatatatttttggataatgctaaagtcacca agtttttaaaccaaattatgtgtcacagtataaaataaacacgttaatca acacttaaataataattcaatcatcaacatctacatcatttgattacaaa aaagtttgtcttcctagcattactctatattttttttatatatacatata ctcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaa aatttaatcataaattatttctattatatattattatattgtcagataaa aatgctcgaaccccagttggtaatgatttggccgaacgta
back to top