GAPDH, GU575233.1-GAPDH (gene) Rosa xanthina

Gene Overview
NameGAPDH
Unique NameGU575233.1-GAPDH
Typegene
OrganismRosa xanthina ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa xanthinagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575233.1-GAPDH.m1Rosa xanthinamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU575233.1
Alignments
Feature NameTypeLocationAnalysis
GU575233 region GU575233:1..755+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU575233.1-GAPDH ID=GU575233.1-GAPDH|Name=GAPDH|organism=Rosa xanthina|type=gene|length=755bp
gtcttatgactaccgtgcactccatcactggtgagttttcacttgaccat
gtgagatatatgaatgttaagatactaaatttgaaaccaactaaagtcgt
ctgtgtatttgtaattcagccacccagaagactgttgatggaccatcagc
aaaggactggagaggtggacgtgctgcctctttcaacatcattcccagca
gcactggagctgccaaggtattttcaatattctttgtgccactgcttcag
tattgttgatacacttttaagttacatgtcagtgatacttcatctttaac
agctttattaatctttgattttggaatatgtttaggctgtcggaaaggtt
ctgcctgctctcaatggcaagttgaccggaatggccttccgtgtgcccac
tgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaa
cctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtc
ttggttctaatcttttatctttaattctgtctcaacagggaggagtctga
gggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaa
ccgacttcattggtgacaacaggtaaatgaatattagtcattcaatggtt
ggagtactatgtacagaataaaccatctatcctgtttggattagtgatca
tcttg
back to top

gene from alignment at GU575233:1..755+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU575233.1-GAPDH ID=GU575233.1-GAPDH|Name=GAPDH|organism=Rosa xanthina|type=gene|length=755bp|location=Sequence derived from alignment at GU575233:1..755+ (Rosa xanthina)
gtcttatgactaccgtgcactccatcactggtgagttttcacttgaccat gtgagatatatgaatgttaagatactaaatttgaaaccaactaaagtcgt ctgtgtatttgtaattcagccacccagaagactgttgatggaccatcagc aaaggactggagaggtggacgtgctgcctctttcaacatcattcccagca gcactggagctgccaaggtattttcaatattctttgtgccactgcttcag tattgttgatacacttttaagttacatgtcagtgatacttcatctttaac agctttattaatctttgattttggaatatgtttaggctgtcggaaaggtt ctgcctgctctcaatggcaagttgaccggaatggccttccgtgtgcccac tgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaa cctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt gttaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtc ttggttctaatcttttatctttaattctgtctcaacagggaggagtctga gggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaa ccgacttcattggtgacaacaggtaaatgaatattagtcattcaatggtt ggagtactatgtacagaataaaccatctatcctgtttggattagtgatca tcttg
back to top