GAPDH, GU575224.1-GAPDH (gene) Rosa helenae

Gene Overview
NameGAPDH
Unique NameGU575224.1-GAPDH
Typegene
OrganismRosa helenae ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa helenaegene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575224.1-GAPDH.m1Rosa helenaemRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU575224.1
Alignments
Feature NameTypeLocationAnalysis
GU575224 region GU575224:1..741+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU575224.1-GAPDH ID=GU575224.1-GAPDH|Name=GAPDH|organism=Rosa helenae|type=gene|length=741bp
gtcttatgactaccgtgcactccatcactggtaagttttcacttgtaacc
atgtgagatatattaatgttaagatactagatttgaaaccaactaaagtc
gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca
gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag
cagcactggagctgccaaggtattttcaatattctttgtgccactgcttc
agtattgttgatgcacttttaagttacatgtcagtgatacttgatctgta
acagctttattaatccttgattttggaatatctttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc
aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg
ttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgtatg
tcttggttctaatcttttatctttaattctgtctcaacagggaggagtct
gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc
aaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatgg
ttggagtgctacgtacagaataaaccatctatgctgtttgg
back to top

gene from alignment at GU575224:1..741+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU575224.1-GAPDH ID=GU575224.1-GAPDH|Name=GAPDH|organism=Rosa helenae|type=gene|length=741bp|location=Sequence derived from alignment at GU575224:1..741+ (Rosa helenae)
gtcttatgactaccgtgcactccatcactggtaagttttcacttgtaacc atgtgagatatattaatgttaagatactagatttgaaaccaactaaagtc gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag cagcactggagctgccaaggtattttcaatattctttgtgccactgcttc agtattgttgatgcacttttaagttacatgtcagtgatacttgatctgta acagctttattaatccttgattttggaatatctttaggctgtcggaaagg ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg ttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgtatg tcttggttctaatcttttatctttaattctgtctcaacagggaggagtct gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc aaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatgg ttggagtgctacgtacagaataaaccatctatgctgtttgg
back to top