GAPDH, GU575222.1-GAPDH (gene) Rosa laevigata

Gene Overview
NameGAPDH
Unique NameGU575222.1-GAPDH
Typegene
OrganismRosa laevigata ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa laevigatagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575222.1-GAPDH.m1Rosa laevigatamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU575222.1
Alignments
Feature NameTypeLocationAnalysis
GU575222 region GU575222:1..762+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU575222.1-GAPDH ID=GU575222.1-GAPDH|Name=GAPDH|organism=Rosa laevigata|type=gene|length=762bp
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgacc
atgtgagatatatgaatgttaatcatttgcatgttttgaaaccaactgaa
gttgtctgtgtrtttgtaattcagccacccagaagactgttgatggacca
tcagccaaggactggagaggtggacgtgctgcctcattcaacatcattcc
cagcagcactggagctgccaaggtattttcaatattctttatgtgactgc
ttcagtattgttgatacatttttaagttaygtgtcaaatgatacttcatc
tttaacagctttattaatccttgattttggaatgtgtttaggctgttgga
aaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgt
acccactgttgatgtttcagttgttgacctcactgtcaggcttgagaagg
cggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaac
tttgttgttaatcagttgcaatcaaggtggggtgtcatgacatkacaatg
catgtgttggttttaatcttttatctttaattctgtctcaacagggagga
gtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttg
tgtcaaccgacttcattggtgacagcaggtaaatgaatattagtcattca
atggttggagtactatgtacagaataaaccatctaatcctgtttggatta
gtgatcatcttg
back to top

gene from alignment at GU575222:1..762+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU575222.1-GAPDH ID=GU575222.1-GAPDH|Name=GAPDH|organism=Rosa laevigata|type=gene|length=762bp|location=Sequence derived from alignment at GU575222:1..762+ (Rosa laevigata)
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgacc atgtgagatatatgaatgttaatcatttgcatgttttgaaaccaactgaa gttgtctgtgtrtttgtaattcagccacccagaagactgttgatggacca tcagccaaggactggagaggtggacgtgctgcctcattcaacatcattcc cagcagcactggagctgccaaggtattttcaatattctttatgtgactgc ttcagtattgttgatacatttttaagttaygtgtcaaatgatacttcatc tttaacagctttattaatccttgattttggaatgtgtttaggctgttgga aaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgt acccactgttgatgtttcagttgttgacctcactgtcaggcttgagaagg cggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaac tttgttgttaatcagttgcaatcaaggtggggtgtcatgacatkacaatg catgtgttggttttaatcttttatctttaattctgtctcaacagggagga gtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttg tgtcaaccgacttcattggtgacagcaggtaaatgaatattagtcattca atggttggagtactatgtacagaataaaccatctaatcctgtttggatta gtgatcatcttg
back to top