GAPDH, GU575221.1-GAPDH (gene) Rosa roxburghii

Gene Overview
NameGAPDH
Unique NameGU575221.1-GAPDH
Typegene
OrganismRosa roxburghii ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa roxburghiigene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575221.1-GAPDH.m1Rosa roxburghiimRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU575221.1
Alignments
Feature NameTypeLocationAnalysis
GU575221 region GU575221:1..695+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU575221.1-GAPDH ID=GU575221.1-GAPDH|Name=GAPDH|organism=Rosa roxburghii|type=gene|length=695bp
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgtcc
atgtgagatttatcaatgttaatcatttgcatgttttgaaactaactgaa
gtcgtctgtgtatttgtaactcagccacccagaagactgttgatggacca
tcagccaaggactggaggggtggacgtgctgcctcattcaacatcattcc
cagcagcactggagctgccaaggtattttcaatattcttcatgtgactgc
ttcaatattgttgatacatttttaagttacatgtcaatgatacttcatct
ttaacagctttattaatccttgattttggaatatgtttaggctgttggaa
aggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggc
ggcaacctatgaccagatcaaggctgccatcaagtaaggcttgttgaact
ttgttgtcaatcagttgcaatcaaggtggggtgtcatgacattacaatgc
atgtcttggttctaatcttttatctttaattctgtctcaacagggaggag
tctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgt
gtcaaccgacttcattggtgacaacaggtaaatgaatattagtca
back to top

gene from alignment at GU575221:1..695+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU575221.1-GAPDH ID=GU575221.1-GAPDH|Name=GAPDH|organism=Rosa roxburghii|type=gene|length=695bp|location=Sequence derived from alignment at GU575221:1..695+ (Rosa roxburghii)
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgtcc atgtgagatttatcaatgttaatcatttgcatgttttgaaactaactgaa gtcgtctgtgtatttgtaactcagccacccagaagactgttgatggacca tcagccaaggactggaggggtggacgtgctgcctcattcaacatcattcc cagcagcactggagctgccaaggtattttcaatattcttcatgtgactgc ttcaatattgttgatacatttttaagttacatgtcaatgatacttcatct ttaacagctttattaatccttgattttggaatatgtttaggctgttggaa aggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta cccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggc ggcaacctatgaccagatcaaggctgccatcaagtaaggcttgttgaact ttgttgtcaatcagttgcaatcaaggtggggtgtcatgacattacaatgc atgtcttggttctaatcttttatctttaattctgtctcaacagggaggag tctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgt gtcaaccgacttcattggtgacaacaggtaaatgaatattagtca
back to top