GAPDH, GU575208.1-GAPDH (gene) Rosa odorata var. gigantea

Gene Overview
NameGAPDH
Unique NameGU575208.1-GAPDH
Typegene
OrganismRosa odorata var. gigantea ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa odorata var. giganteagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575208.1-GAPDH.m1Rosa odorata var. giganteamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU575208.1
Alignments
Feature NameTypeLocationAnalysis
GU575208 region GU575208:1..717+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU575208.1-GAPDH ID=GU575208.1-GAPDH|Name=GAPDH|organism=Rosa odorata var. gigantea|type=gene|length=717bp
catgtgagatatatgaatgttaagatactagatttgaaaccaactaaagt
cgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatc
agcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggtattttcaatattctttgtgccactgctt
cagtattgttgatacacttttaagttgcatgtcagtgatacttcatctgt
aacagctttattaatccttgattttggaatatctttaggctgtcggaaag
gtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaagtaaggcttgttgaacttt
gttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcgt
gtcttggttctaatcttttatctttaattctgtctgaatagggaggagtc
tgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgt
caacagacttcattggtgacaacaggtaaatgaatattagtcatttaatg
catttaatggttggagtactacgtacagaataaaccatctatgctgtttg
gattagtgatcatcttg
back to top

gene from alignment at GU575208:1..717+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU575208.1-GAPDH ID=GU575208.1-GAPDH|Name=GAPDH|organism=Rosa odorata var. gigantea|type=gene|length=717bp|location=Sequence derived from alignment at GU575208:1..717+ (Rosa odorata var. gigantea)
catgtgagatatatgaatgttaagatactagatttgaaaccaactaaagt cgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatc agcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca gcagcactggagctgccaaggtattttcaatattctttgtgccactgctt cagtattgttgatacacttttaagttgcatgtcagtgatacttcatctgt aacagctttattaatccttgattttggaatatctttaggctgtcggaaag gtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacc cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg caacctatgaccagatcaaggctgctatcaagtaaggcttgttgaacttt gttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcgt gtcttggttctaatcttttatctttaattctgtctgaatagggaggagtc tgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgt caacagacttcattggtgacaacaggtaaatgaatattagtcatttaatg catttaatggttggagtactacgtacagaataaaccatctatgctgtttg gattagtgatcatcttg
back to top