GAPDH, GU575201.1-GAPDH (gene) Rosa odorata var. pseudindica

Gene Overview
NameGAPDH
Unique NameGU575201.1-GAPDH
Typegene
OrganismRosa odorata var. pseudindica ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa odorata var. pseudindicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575201.1-GAPDH.m1Rosa odorata var. pseudindicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU575201.1
Alignments
Feature NameTypeLocationAnalysis
GU575201 region GU575201:1..757+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU575201.1-GAPDH ID=GU575201.1-GAPDH|Name=GAPDH|organism=Rosa odorata var. pseudindica|type=gene|length=757bp
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc
atgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtc
gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca
gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag
cagcactggagctgccaaggtattttcaatattctttgggccactgcttc
agtattgttgatacacttttaagttacatgtcagtgatacttcatctgta
acagctttattaatccttgattttggaatatctttaggctgttggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc
aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg
ttgtcaattagttgcaatcaaggtggggtgtcatcacattacaatgcatg
tcttggttctaatcttttatctttaattctgtctgaacagggaggagtct
gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc
aaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatgg
ttggagtactacgtacagaataaaccatctatgctgtttggattagtgat
catcttg
back to top

gene from alignment at GU575201:1..757+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU575201.1-GAPDH ID=GU575201.1-GAPDH|Name=GAPDH|organism=Rosa odorata var. pseudindica|type=gene|length=757bp|location=Sequence derived from alignment at GU575201:1..757+ (Rosa odorata var. pseudindica)
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaacc atgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtc gtctgtgtatttgcaattcagccacccagaagactgttgatggaccatca gcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccag cagcactggagctgccaaggtattttcaatattctttgggccactgcttc agtattgttgatacacttttaagttacatgtcagtgatacttcatctgta acagctttattaatccttgattttggaatatctttaggctgttggaaagg ttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggc aacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttg ttgtcaattagttgcaatcaaggtggggtgtcatcacattacaatgcatg tcttggttctaatcttttatctttaattctgtctgaacagggaggagtct gagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtc aaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatgg ttggagtactacgtacagaataaaccatctatgctgtttggattagtgat catcttg
back to top