ASG3, AF403124.1-ASG3.m1 (mRNA) Malus x domestica

Transcript Overview
NameASG3
Unique NameAF403124.1-ASG3.m1
TypemRNA
OrganismMalus x domestica (Apple)
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ASG3ASG3Malus x domesticagene


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF403124.1-ASG3.m1-cds1AF403124.1-ASG3.m1-cds1Malus x domesticaCDS


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ASG3AF403124.1-ASG3.p1Malus x domesticapolypeptide


Cross References
External references for this mRNA
DatabaseAccession
GI33308676
nuccoreAF403124.1
Alignments
Feature NameTypeLocationAnalysis
AF403124 region AF403124:90..317+ NCBI Rosaceae gene and mRNA sequences
Chr11 chromosome Chr11:2571236..2571463- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr11 chromosome chr11:2885718..2885945- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr11 chromosome chr11:2885382..2885609- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr11 chromosome chr11:3285719..3285946- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Properties
Property NameValue
Productanther-specific protein ASG3
Sourcegenbank
Genbank noteMdASG3
Sequences
The following sequences are available for this feature:

mRNA sequence

>AF403124.1-ASG3.m1 ID=AF403124.1-ASG3.m1|Name=ASG3|organism=Malus x domestica|type=mRNA|length=228bp
atggccatgaagaagattgccttggttgtcctggtggttgctgtctgcat
gtccgcagctatggcagctgcacctctaaaggctgcagctgctaccccag
ctgccacccctgcggcagctcccgtctccgatgcttctgttccagcacct
aatggaagcaacatgaacgccgttggatctctgatcggagcttcagtctt
gtccttcttggccctttacttgcactaa
back to top

protein sequence of ASG3

>AF403124.1-ASG3.p1 ID=AF403124.1-ASG3.p1|Name=ASG3|organism=Malus x domestica|type=polypeptide|length=75bp
MAMKKIALVVLVVAVCMSAAMAAAPLKAAAATPAATPAAAPVSDASVPAP
NGSNMNAVGSLIGASVLSFLALYLH
back to top

mRNA from alignment at AF403124:90..317+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF403124.1-ASG3.m1 ID=AF403124.1-ASG3.m1|Name=ASG3|organism=Malus x domestica|type=mRNA|length=228bp|location=Sequence derived from alignment at AF403124:90..317+ (Malus x domestica)
atggccatgaagaagattgccttggttgtcctggtggttgctgtctgcat gtccgcagctatggcagctgcacctctaaaggctgcagctgctaccccag ctgccacccctgcggcagctcccgtctccgatgcttctgttccagcacct aatggaagcaacatgaacgccgttggatctctgatcggagcttcagtctt gtccttcttggccctttacttgcactaa
back to top

Coding sequence (CDS) from alignment at AF403124:90..317+

>AF403124.1-ASG3.m1 ID=AF403124.1-ASG3.m1|Name=ASG3|organism=Malus x domestica|type=CDS|length=228bp|location=Sequence derived from alignment at AF403124:90..317+ (Malus x domestica)
atggccatgaagaagattgccttggttgtcctggtggttgctgtctgcat
gtccgcagctatggcagctgcacctctaaaggctgcagctgctaccccag
ctgccacccctgcggcagctcccgtctccgatgcttctgttccagcacct
aatggaagcaacatgaacgccgttggatctctgatcggagcttcagtctt
gtccttcttggccctttacttgcactaa
back to top