LFY1, GU991423.1-LFY1 (gene) Malus x domestica

Gene Overview
NameLFY1
Unique NameGU991423.1-LFY1
Typegene
OrganismMalus x domestica (Apple)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Malus x domesticagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFY1GU991423.1-LFY1.m1Malus x domesticamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU991423.1
Alignments
Feature NameTypeLocationAnalysis
GU991423 region GU991423:1..1055+ NCBI Rosaceae gene and mRNA sequences
Chr06 chromosome Chr06:27319211..27320358+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr11 chromosome chr11:20415789..20416937+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr11 chromosome chr11:23582433..23583581- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU991423.1-LFY1 ID=GU991423.1-LFY1|Name=LFY1|organism=Malus x domestica|type=gene|length=1055bp
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagta
gggatggcgtgggaggttgtgacggcggggcagaggcggaagaagcagcg
gaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatg
ataatgatcaaaacgagggtgtagacgacaaggacgacgacatggacaac
atgaatgggcaggggaacggtggaggaggggggttgctaggcgagagaca
gagggagcacccgttcattgtgacggagcctggggaggtggcacgtggca
aaaagaacggtcttgattacctcttctatctctacgagctgtgccgtgat
ttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc
aaccaaggttggacgttcatcaataaagaaaaagactcttatactcatgt
ataaaattaccacaaagacttggtgattgtctaagaaaaacagttatggg
gttttttttcactgtattcaccgcattgatgcaccttgttggtatgcact
ggaaacttaggtagttgaccctaagcgttatttacacactcatttttacc
tttcacacattattctcaattcatggtcgttggatcgaataaattaaaaa
agatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtg
tgtgataaaagcactactaaaagcacttctttccagttatgaacaacaca
ttttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt
cgattacatcgaatttgatacatgcggtctgcaaattttgtcaatttaag
aatatccgtcaacttttgtgaatttcttgtacgaaatctgttaaattcat
catcgtacaagaaattcacattgttgatgaatattctttgaattggaact
actttcttacatcatgagtcaaatttgatgcaatcgaaaatacatgaatg
aaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagtt
cggct
back to top

gene from alignment at GU991423:1..1055+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU991423.1-LFY1 ID=GU991423.1-LFY1|Name=LFY1|organism=Malus x domestica|type=gene|length=1055bp|location=Sequence derived from alignment at GU991423:1..1055+ (Malus x domestica)
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagta gggatggcgtgggaggttgtgacggcggggcagaggcggaagaagcagcg gaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatg ataatgatcaaaacgagggtgtagacgacaaggacgacgacatggacaac atgaatgggcaggggaacggtggaggaggggggttgctaggcgagagaca gagggagcacccgttcattgtgacggagcctggggaggtggcacgtggca aaaagaacggtcttgattacctcttctatctctacgagctgtgccgtgat ttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc aaccaaggttggacgttcatcaataaagaaaaagactcttatactcatgt ataaaattaccacaaagacttggtgattgtctaagaaaaacagttatggg gttttttttcactgtattcaccgcattgatgcaccttgttggtatgcact ggaaacttaggtagttgaccctaagcgttatttacacactcatttttacc tttcacacattattctcaattcatggtcgttggatcgaataaattaaaaa agatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtg tgtgataaaagcactactaaaagcacttctttccagttatgaacaacaca ttttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt cgattacatcgaatttgatacatgcggtctgcaaattttgtcaatttaag aatatccgtcaacttttgtgaatttcttgtacgaaatctgttaaattcat catcgtacaagaaattcacattgttgatgaatattctttgaattggaact actttcttacatcatgagtcaaatttgatgcaatcgaaaatacatgaatg aaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagtt cggct
back to top

gene from alignment at Chr06:27319211..27320358+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU991423.1-LFY1 ID=GU991423.1-LFY1|Name=LFY1|organism=Malus x domestica|type=gene|length=1148bp|location=Sequence derived from alignment at Chr06:27319211..27320358+ (Malus x domestica)
TGTCGGAGGAGCCAGTGCAACAAGAGAAGGAGATGGTGGGGACCGGAGTA GGGATGGCGTGGGAGGTTGTGACGGCGGGGCAGAGGCGGAAGAAGCAGCG GAGGATGAAGAAGGGGCAATATAGGAACTGTAGTGCTGGAGGGGGTCATG ATAATGATCATAACGAGGGTGTAGACGACAAGGACGACGACATGGACAAC ATGAATGGGCAGGGGAACGGTGGAGGAGGGGGGTTGCTAGGCGAGAGACA GAGGGAGCACCCGTTCATTGTGACGGAGCCTGGGGAGGTGGCACGTGGCA AAAAGAACGGTCTTGATTACCTCTTCTATCTCTACGAGCTGTGCCGTGAT TTCTTGATCCAGGTCCAGAACATTGCCAAGGAGCGCGGTGAAAAATGTCC AACCAAGGTACGGAGTTTACCCATGATTTCATAAGCGGATTTTTACTGTG GTAAATACAGTAAACTCATCTTGAGTGGTTCTCTGTACACCCACGTTTGA TTTCTGGACGTTCATCAATAAAGAAAAAGACTCTTATACTCATGTATAAA ATTACCACAAAGACTTGGTGATTGTCTAAGAAAAACAGTTATGGGGTTTT TTTTCACTGTATTCACCGCATTGATGCACCTTGTTGGTATGCACTGGAAA CTTAGGTAGTTGACCCTAAGCGTTATTTACACACTCATTTTTACCTTTCA CACATTATTCTCAATTCATGGTCGTTGGATCGAATAAATTAAAAAAGATC AATTGACCAAAATTAATAAGAATGTGTCAGAGGTAAATAGATGTGTGTGA AAAGCACTACTAAAAGCACTTCTTTCCAGTTATGAACAACACATTTTCAA TCAATTTAGATTTGGCAAAGTTTCACTTTCGTTTATGTATTTTCGATTAC ATCGAATTTGATACATGCGGTCTGCAAATTTTGTCAATTTAAGAATATCC GTCAACTTTTGTGAATTTCTTGTACGAAATCTGTTAAATTCATCATCGTA CAAGAAATTCACATTGTTGATGAATATTCTTTGAATTGGAACTACTTTCT TACATCATGAGTCAAATTTGATGCAATCGAAAATACATGAATGAAAGTAG GTCAGTTTGTAGTCCAAAAGTAATTTGATTCAACTATTTAGTTCGGCT
back to top