LFY1, GU991409.1-LFY1 (gene) Pyrus hondoensis

Gene Overview
NameLFY1
Unique NameGU991409.1-LFY1
Typegene
OrganismPyrus hondoensis ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Pyrus hondoensisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFY1GU991409.1-LFY1.m1Pyrus hondoensismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU991409.1
Alignments
Feature NameTypeLocationAnalysis
GU991409 region GU991409:1..1042+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU991409.1-LFY1 ID=GU991409.1-LFY1|Name=LFY1|organism=Pyrus hondoensis|type=gene|length=1042bp
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagta
gggacggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcg
gaggatgaagaagggccaatataggaactgtagtgctggagggggtcata
ataatgatcataacgagggtgtagacgacaaggacgacatgaatgggcag
gggaacggtggaggaggggggttgctaggcgagagacagagggagcaccc
gttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtc
ttgattacctcttccatctctacgagcagtgccgtgatttcttgatccag
gtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattacca
caaagacttggtgattgtctaagaaaaacaattatggggtttttttcact
gtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtag
ttgaaccctaagcgttatctacacactcatttttacctctcacacatcat
tctcaattcatggccgtcatattgaatgaattgaaaaagatcaattgacc
aaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacg
ctactaaaagcacttctttccggttatgaacaatacattttcaatcaatt
tagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcggtctgaaaatcttgtcaatttaagaatatccgtcaac
ttccgtgaatttcttgtatgaaatctgttaaatttatcctcgtataagaa
atttacattgttgatgaatattctttgaattggaactactttcttacatc
atgagtcaaatttgatgcaatccaaaatacatgaatgaaagtaagtcagt
ttgtagtccaaaagtaatttgattcaactatttagttcgact
back to top

gene from alignment at GU991409:1..1042+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU991409.1-LFY1 ID=GU991409.1-LFY1|Name=LFY1|organism=Pyrus hondoensis|type=gene|length=1042bp|location=Sequence derived from alignment at GU991409:1..1042+ (Pyrus hondoensis)
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagta gggacggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcg gaggatgaagaagggccaatataggaactgtagtgctggagggggtcata ataatgatcataacgagggtgtagacgacaaggacgacatgaatgggcag gggaacggtggaggaggggggttgctaggcgagagacagagggagcaccc gttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtc ttgattacctcttccatctctacgagcagtgccgtgatttcttgatccag gtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg acgttcatcaataaagaaaaagactattatactcatatataaaattacca caaagacttggtgattgtctaagaaaaacaattatggggtttttttcact gtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtag ttgaaccctaagcgttatctacacactcatttttacctctcacacatcat tctcaattcatggccgtcatattgaatgaattgaaaaagatcaattgacc aaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacg ctactaaaagcacttctttccggttatgaacaatacattttcaatcaatt tagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa tttaatacatgcggtctgaaaatcttgtcaatttaagaatatccgtcaac ttccgtgaatttcttgtatgaaatctgttaaatttatcctcgtataagaa atttacattgttgatgaatattctttgaattggaactactttcttacatc atgagtcaaatttgatgcaatccaaaatacatgaatgaaagtaagtcagt ttgtagtccaaaagtaatttgattcaactatttagttcgact
back to top