LFY1, GU991406.1-LFY1 (gene) Pyrus hopeiensis

Gene Overview
NameLFY1
Unique NameGU991406.1-LFY1
Typegene
OrganismPyrus hopeiensis ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Pyrus hopeiensisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFY1GU991406.1-LFY1.m1Pyrus hopeiensismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreGU991406.1
Alignments
Feature NameTypeLocationAnalysis
GU991406 region GU991406:1..1041+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU991406.1-LFY1 ID=GU991406.1-LFY1|Name=LFY1|organism=Pyrus hopeiensis|type=gene|length=1041bp
tgtcggaggagccagtgcaacaagaggaggagatggcggggagcggagta
gggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcg
gaggatgaagaagggccaatataggaactgtagtgctggagggggtcata
ataatgatcataacgagggtgtagacgacaaggacgacatgaatgggcag
gggaacggtggaggaggggggttgctaggcgagagacagagggagcaccc
gttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtc
ttgattacctcttccatctctacgagcagtgccgtgatttcttgatccag
gtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattacca
caaagacttggtgattgtctaagaaaaacaattatggggtttttttcact
gtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtag
ttgaaccctaagcgttatctacacactcatttttacctctcacacatcat
tctcaattcacggccgtcatattgaatgaattgaaaaagatcaattgacc
aaaattaataagaatgtgtcagagataaaagatgtgtgtgataaaaacgc
tactaaaagcacttctttccggttatgaacaacacattttcaatcaattt
agatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaat
ttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaact
tccgtgaatttcttgtatgaaatctgttaaatttatcctcgtataagaaa
tttacattgttgatgaatattctttgaattggaactactttcttacatca
tgggtcaaatttgatgcaatccaaaatacatgaatgaaagtaagtcagtt
tgtagtccaaaagtaatttgattcaactatttagttcgact
back to top

gene from alignment at GU991406:1..1041+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>GU991406.1-LFY1 ID=GU991406.1-LFY1|Name=LFY1|organism=Pyrus hopeiensis|type=gene|length=1041bp|location=Sequence derived from alignment at GU991406:1..1041+ (Pyrus hopeiensis)
tgtcggaggagccagtgcaacaagaggaggagatggcggggagcggagta gggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcg gaggatgaagaagggccaatataggaactgtagtgctggagggggtcata ataatgatcataacgagggtgtagacgacaaggacgacatgaatgggcag gggaacggtggaggaggggggttgctaggcgagagacagagggagcaccc gttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtc ttgattacctcttccatctctacgagcagtgccgtgatttcttgatccag gtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg acgttcatcaataaagaaaaagactattatactcatatataaaattacca caaagacttggtgattgtctaagaaaaacaattatggggtttttttcact gtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtag ttgaaccctaagcgttatctacacactcatttttacctctcacacatcat tctcaattcacggccgtcatattgaatgaattgaaaaagatcaattgacc aaaattaataagaatgtgtcagagataaaagatgtgtgtgataaaaacgc tactaaaagcacttctttccggttatgaacaacacattttcaatcaattt agatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaat ttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaact tccgtgaatttcttgtatgaaatctgttaaatttatcctcgtataagaaa tttacattgttgatgaatattctttgaattggaactactttcttacatca tgggtcaaatttgatgcaatccaaaatacatgaatgaaagtaagtcagtt tgtagtccaaaagtaatttgattcaactatttagttcgact
back to top