ANR, HM026188.1-ANR.m1 (mRNA) Fragaria chiloensis

Transcript Overview
Unique NameHM026188.1-ANR.m1
OrganismFragaria chiloensis ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRFragaria chiloensisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM026188.1-ANR.m1-cds1HM026188.1-ANR.m1-cds1Fragaria chiloensisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ANRHM026188.1-ANR.p1Fragaria chiloensispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM026188 region HM026188:1..543+ NCBI Rosaceae gene and mRNA sequences
LG5 chromosome LG5:67800..68686+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Productanthocyanidin reductase
Genbank noteANR
The following sequences are available for this feature:

mRNA sequence

>HM026188.1-ANR.m1 ID=HM026188.1-ANR.m1|Name=ANR|organism=Fragaria chiloensis|type=mRNA|length=543bp
back to top

protein sequence of ANR

>HM026188.1-ANR.p1 ID=HM026188.1-ANR.p1|Name=ANR|organism=Fragaria chiloensis|type=polypeptide|length=180bp
back to top

mRNA from alignment at HM026188:1..543+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM026188.1-ANR.m1 ID=HM026188.1-ANR.m1|Name=ANR|organism=Fragaria chiloensis|type=mRNA|length=543bp|location=Sequence derived from alignment at HM026188:1..543+ (Fragaria chiloensis)
acaactgccaagccacctacttggggatatcctgtttcaaaggtactagc tgagaagacagcatggaaatttgctgaagaaaacaacattgatctcatca ctgtgatcccttctctcatggctggtgcttctctcactccagacatcccc agcagtataggcctcgccacgtctttaattacgggaaatgagttcctcat aaatggcttgaaaggcatgcaaatgctatcaggttccatatccattacac atgtggaggatgtctgccgagctcatatatttttggcagagaaagaatct gcttctggtcggtacatatgctgtgctgaaaatagtagtgttcctgaggt tgcaaagttcctcagcaaaagatatcccgaatacaaagtcccgactgagt ttggagattttccatccaaggcgaagaccatactctcttcagaaaagctt aagaaggaggggttcactttcaagtacgggattgaagacatatatgacca aactgtggagtacttgaaacttaagggggtgctgcagaactag
back to top

Coding sequence (CDS) from alignment at HM026188:1..543+

>HM026188.1-ANR.m1 ID=HM026188.1-ANR.m1|Name=ANR|organism=Fragaria chiloensis|type=CDS|length=543bp|location=Sequence derived from alignment at HM026188:1..543+ (Fragaria chiloensis)
back to top