F3H, HM026183.1-F3H.m1 (mRNA) Fragaria chiloensis

Transcript Overview
Unique NameHM026183.1-F3H.m1
OrganismFragaria chiloensis ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HFragaria chiloensisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM026183.1-F3H.m1-cds1HM026183.1-F3H.m1-cds1Fragaria chiloensisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HHM026183.1-F3H.p1Fragaria chiloensispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM026183 region HM026183:1..478+ NCBI Rosaceae gene and mRNA sequences
LG1 chromosome LG1:7929792..7930775- Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Genbank noteF3H
The following sequences are available for this feature:

mRNA sequence

>HM026183.1-F3H.m1 ID=HM026183.1-F3H.m1|Name=F3H|organism=Fragaria chiloensis|type=mRNA|length=478bp
back to top

protein sequence of F3H

>HM026183.1-F3H.p1 ID=HM026183.1-F3H.p1|Name=F3H|organism=Fragaria chiloensis|type=polypeptide|length=158bp
back to top

mRNA from alignment at HM026183:1..478+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM026183.1-F3H.m1 ID=HM026183.1-F3H.m1|Name=F3H|organism=Fragaria chiloensis|type=mRNA|length=478bp|location=Sequence derived from alignment at HM026183:1..478+ (Fragaria chiloensis)
cggtgcaggattggcgcgagattgtgacctacttctcatacccggtgcgc caccgtgactactcgaggtggtcggacaagcccgaggggtggagagatgt gacaacgcagtacagtgacgagctgatggggttggcatgcaagctattgg aggttttatcagaggccatgggtttagagaaggaggcattgacaaaggca tgtgtggacatggaccaaaaggttgtggtgaatttctacccgaaatgccc ccagccggacctcactctcggactcaaacgccacacggatcccggtacca ttacccttttgctgcaggaccaagtcggtggacttcaggccaccagggac ggcggaaagacgtggatcaccgttcaacctgtggaaggagctttcgtggt gaatcttggagaccatggacattttctgagcaatgggaggttcaagaatg ctgatcaccaggcggtggtgaactcaaa
back to top

Coding sequence (CDS) from alignment at HM026183:1..478+

>HM026183.1-F3H.m1 ID=HM026183.1-F3H.m1|Name=F3H|organism=Fragaria chiloensis|type=CDS|length=478bp|location=Sequence derived from alignment at HM026183:1..478+ (Fragaria chiloensis)
back to top