COX2, HQ731509.1-COX2 (gene) Rubus coreanus

Gene Overview
NameCOX2
Unique NameHQ731509.1-COX2
Typegene
OrganismRubus coreanus ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COX2COX2Rubus coreanusgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
COX2HQ731509.1-COX2.m1Rubus coreanusmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreHQ731509.1
Alignments
Feature NameTypeLocationAnalysis
HQ731509 region HQ731509:2..769+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>HQ731509.1-COX2 ID=HQ731509.1-COX2|Name=COX2|organism=Rubus coreanus|type=gene|length=768bp
atgattgttctagaatggctattcctcacaattgctccttgtgatgcagc
ggaaccatggcaattaggatttcaagacgcagcaacccctatgatgcaag
gaataatggacttacatcacgatatctttttcttcctcattctgattttg
gttttcgtatcacggatcttggttcgcgctttatggcatttccactataa
aaaaaatccaatcccgcaaaggattgttcatggaactactatcgagattc
ttcggaccatatttcctagtatcatcccgatgttcattgctataccatca
tttgctttgttatactcaatggacgaggtagtagtagatccagccattac
tatcaaagctattggacatcaatggtatcggacttatgagtattcagact
ataacagttccgatgaacagtcactcacttttgacagttatacgattcca
gaagatgatctagaattgggtcaatcgcgtttattagaagtggacaatag
agtggttgtaccagccaaaactcatctacgtattattgtaacacctgctg
atgtacttcatagttgggctgtaccttcctcaggtgtcaaatgtgatgct
gtacctggtcgtttaaatcagatctctatttcggtacaacgagaaggagt
ttactatggtcagtgcagtgagatttgtggaactaatcatgcctttacgc
ctatcgtcgtagaagctgttcctaggaaagattatggttctcgggtatcc
aatcaattaatcccataa
back to top

gene from alignment at HQ731509:2..769+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ731509.1-COX2 ID=HQ731509.1-COX2|Name=COX2|organism=Rubus coreanus|type=gene|length=768bp|location=Sequence derived from alignment at HQ731509:2..769+ (Rubus coreanus)
atgattgttctagaatggctattcctcacaattgctccttgtgatgcagc ggaaccatggcaattaggatttcaagacgcagcaacccctatgatgcaag gaataatggacttacatcacgatatctttttcttcctcattctgattttg gttttcgtatcacggatcttggttcgcgctttatggcatttccactataa aaaaaatccaatcccgcaaaggattgttcatggaactactatcgagattc ttcggaccatatttcctagtatcatcccgatgttcattgctataccatca tttgctttgttatactcaatggacgaggtagtagtagatccagccattac tatcaaagctattggacatcaatggtatcggacttatgagtattcagact ataacagttccgatgaacagtcactcacttttgacagttatacgattcca gaagatgatctagaattgggtcaatcgcgtttattagaagtggacaatag agtggttgtaccagccaaaactcatctacgtattattgtaacacctgctg atgtacttcatagttgggctgtaccttcctcaggtgtcaaatgtgatgct gtacctggtcgtttaaatcagatctctatttcggtacaacgagaaggagt ttactatggtcagtgcagtgagatttgtggaactaatcatgcctttacgc ctatcgtcgtagaagctgttcctaggaaagattatggttctcgggtatcc aatcaattaatcccataa
back to top