MYB10, HM585181.1-MYB10.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameHM585181.1-MYB10.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
MYB10MYB10Pyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM585181.1-MYB10.m1-cds1HM585181.1-MYB10.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MYB10HM585181.1-MYB10.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM585181 region HM585181:1..735+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductMYB10 protein
Genbank notePyMYB10; R2R3MYB protein; anthocyanin biosynthesis regulator
The following sequences are available for this feature:

mRNA sequence

>HM585181.1-MYB10.m1 ID=HM585181.1-MYB10.m1|Name=MYB10|organism=Pyrus pyrifolia|type=mRNA|length=735bp
back to top

protein sequence of MYB10

>HM585181.1-MYB10.p1 ID=HM585181.1-MYB10.p1|Name=MYB10|organism=Pyrus pyrifolia|type=polypeptide|length=244bp
back to top

mRNA from alignment at HM585181:1..735+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM585181.1-MYB10.m1 ID=HM585181.1-MYB10.m1|Name=MYB10|organism=Pyrus pyrifolia|type=mRNA|length=735bp|location=Sequence derived from alignment at HM585181:1..735+ (Pyrus pyrifolia)
atggagggatataacgttaacttgagtgtgagaaaaggtgcctggactcg agaggaagacaatcttctcaggcagtgcattgagattcatggagagggaa agtggaaccaggtttcatacaaagcaggcttaaacaggtgcaggaagagc tgcagacaaagatggttaaactatctgaagccaaatatcaagagaggaga ctttaaagaggatgaagtagatcttatacttagacttcacaagcttttgg gaaacaggtggtcattgattgctagaagacttccaggaagaacagcgaat gatgtgaaaaattattggaacactcgattgcggatcgattctcgcatgaa aacgttgaaaaataaatctcaagaaacgagaaagaccaatgtgataagac ctcagccccaaaaattcatcaaaagttcatattacttaagcagtaaagaa ccaattctagaacatattcaatcagcagaagatttaagtacgccatcaca aacgtcgtcgccaacaaagaacggaaatgattggtgggagaccttgttag aaggcgaggatacttttgaaagggctccatgtcccagcattgagttagag gaagaactcttcacaactttttggtttgatgatcgactgtcggcaagatc atgtgccaattttcctgaagaaggacaaagtagaagtgaattctccttta gcatggacctttggaatcattcaaaagaagaatag
back to top

Coding sequence (CDS) from alignment at HM585181:1..735+

>HM585181.1-MYB10.m1 ID=HM585181.1-MYB10.m1|Name=MYB10|organism=Pyrus pyrifolia|type=CDS|length=735bp|location=Sequence derived from alignment at HM585181:1..735+ (Pyrus pyrifolia)
back to top