IAA7A, DQ848595.1-IAA7A.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameDQ848595.1-IAA7A.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
IAA7AIAA7AMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ848595.1-IAA7A.m1-cds1DQ848595.1-IAA7A.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
IAA7ADQ848595.1-IAA7A.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ848595 region DQ848595:1..465+ NCBI Rosaceae gene and mRNA sequences
Chr10 chromosome Chr10:28909741..28911138- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr10 chromosome chr10:19788079..19789477+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr10 chromosome chr10:22660835..22662233- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductAUX/IAA7 A
Genbank notealternatively spliced
The following sequences are available for this feature:

mRNA sequence

>DQ848595.1-IAA7A.m1 ID=DQ848595.1-IAA7A.m1|Name=IAA7A|organism=Malus x domestica|type=mRNA|length=465bp
back to top

protein sequence of IAA7A

>DQ848595.1-IAA7A.p1 ID=DQ848595.1-IAA7A.p1|Name=IAA7A|organism=Malus x domestica|type=polypeptide|length=154bp
back to top

mRNA from alignment at DQ848595:1..465+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ848595.1-IAA7A.m1 ID=DQ848595.1-IAA7A.m1|Name=IAA7A|organism=Malus x domestica|type=mRNA|length=465bp|location=Sequence derived from alignment at DQ848595:1..465+ (Malus x domestica)
gggtggccaccggtgagatcttttcgaaagaacatgttcacggtggtgca aaagagcacgaatgatggagaaagtgagcagatgaacaagggcagcaata ataatgcagttttggtgaaggttagcatggatggtgcaccataccttcgc aaggtcgacttgaagatgtacaagagttaccctgagctctctgatgccct agccaaaatgttcagctccttcaccattggaaattgtggatcccaaggaa tgaaggacttcatgaatgagagaaagctgatggatgttctcaacggttct gattacattccaacatacgaagacaaggatggtgattggatgctggttgg cgatgtgccatgggagatgtttgttgaatcatgcaagagattgcgcataa tgaagagcaaggaggctgttggactagcaccaagggccatggagaaatgc aagaacaggagctga
back to top

Coding sequence (CDS) from alignment at DQ848595:1..465+

>DQ848595.1-IAA7A.m1 ID=DQ848595.1-IAA7A.m1|Name=IAA7A|organism=Malus x domestica|type=CDS|length=465bp|location=Sequence derived from alignment at DQ848595:1..465+ (Malus x domestica)
back to top