S3-RNase, AB537563.1-S3-RNase (gene) Prunus persica

Gene Overview
NameS3-RNase
Unique NameAB537563.1-S3-RNase
Typegene
OrganismPrunus persica (Peach)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S3-RNaseS3-RNasePrunus persicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB537563.1-S3-RNase.m1Prunus persicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAB537563.1
Alignments
Feature NameTypeLocationAnalysis
AB537563 region AB537563:314..1510+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AB537563.1-S3-RNase ID=AB537563.1-S3-RNase|Name=S3-RNase|organism=Prunus persica|type=gene|length=1197bp
atggggatgctgaaattgtcactcgctttccttgttcttgcttttgcttt
cttcttgtgtttcattatgagcgctggtgatggtgggttgcgttacaatc
gtttgctctatatatctacatgcatataatcagcattgcttttttctact
cgtattttttgttcagggaaactattgtgtgtattcgatgatatatcaca
tgacatgcggtgtattgcattcacccacatatttatcatttaatctaacg
cacaactttctttggataagtaagtattggggattgcttttctgcatgtc
ctctttttatttgcatccctttttttttattctgataattgttgcaataa
gcgtagcctattcatcacaataattttggcaggatcttacaactattttc
aatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcga
ccttgctccaacccccggccattacaatatttcaccatccatggcctatg
gccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcaa
aatttgaggacaggaaagtggtatgtattgtttcattatttttttactta
ctctttagttggaaaagtggaccgccaggcacgtatatttacaataatga
atctgatcatctaatcaaaggatcaaaattcaagattcaatatttaatga
aaaaaaacaaaaacaatctcatccaaaaatgaaagtctatttttttctaa
aaatatgtatatattgcttggatgtctcagtaccctaaattgcgagccaa
actgaagaaatcttggccggacgtggaaagcggtaatgatacaagatttt
gggaaggcgaatggaacaaacatggtacatgttccgaacagacacttaac
caaatgcaatacttcgagagatcccacgcattttggaacatgcgcaatat
tacagaaatccttaaaaacgcttcaatcgtaccaagtgcgacacagacgt
ggagctacgcggacatagtatcacctattaaagcagtaactcaaaaaaca
cccctccttcgttgcaaaagtaatccagcaactaatactgagttgttaca
tgaagtggtattttgttatgaatataatgccttaaagctgattgactgta
atcgaacagcaggatgcaaaaatcaacaacgcatctcgtttcaataa
back to top

gene from alignment at AB537563:314..1510+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB537563.1-S3-RNase ID=AB537563.1-S3-RNase|Name=S3-RNase|organism=Prunus persica|type=gene|length=1197bp|location=Sequence derived from alignment at AB537563:314..1510+ (Prunus persica)
atggggatgctgaaattgtcactcgctttccttgttcttgcttttgcttt cttcttgtgtttcattatgagcgctggtgatggtgggttgcgttacaatc gtttgctctatatatctacatgcatataatcagcattgcttttttctact cgtattttttgttcagggaaactattgtgtgtattcgatgatatatcaca tgacatgcggtgtattgcattcacccacatatttatcatttaatctaacg cacaactttctttggataagtaagtattggggattgcttttctgcatgtc ctctttttatttgcatccctttttttttattctgataattgttgcaataa gcgtagcctattcatcacaataattttggcaggatcttacaactattttc aatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcga ccttgctccaacccccggccattacaatatttcaccatccatggcctatg gccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcaa aatttgaggacaggaaagtggtatgtattgtttcattatttttttactta ctctttagttggaaaagtggaccgccaggcacgtatatttacaataatga atctgatcatctaatcaaaggatcaaaattcaagattcaatatttaatga aaaaaaacaaaaacaatctcatccaaaaatgaaagtctatttttttctaa aaatatgtatatattgcttggatgtctcagtaccctaaattgcgagccaa actgaagaaatcttggccggacgtggaaagcggtaatgatacaagatttt gggaaggcgaatggaacaaacatggtacatgttccgaacagacacttaac caaatgcaatacttcgagagatcccacgcattttggaacatgcgcaatat tacagaaatccttaaaaacgcttcaatcgtaccaagtgcgacacagacgt ggagctacgcggacatagtatcacctattaaagcagtaactcaaaaaaca cccctccttcgttgcaaaagtaatccagcaactaatactgagttgttaca tgaagtggtattttgttatgaatataatgccttaaagctgattgactgta atcgaacagcaggatgcaaaaatcaacaacgcatctcgtttcaataa
back to top