LFY, EU500503.1-LFY (gene) Crataegus sp. 2001_29

Gene Overview
NameLFY
Unique NameEU500503.1-LFY
Typegene
OrganismCrataegus sp. 2001_29 ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus sp. 2001_29gene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500503.1-LFY.m1Crataegus sp. 2001_29mRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500503.1
Alignments
Feature NameTypeLocationAnalysis
EU500503 region EU500503:1..1057+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500503.1-LFY ID=EU500503.1-LFY|Name=LFY|organism=Crataegus sp. 2001_29|type=gene|length=1057bp
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggtta
tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt
tccaggcttatggggttagatactacacggcggcgaagatagcggagctt
ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga
aatgatgagcagcctctctcatatattccgctgggagttgcttgttgggg
agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag
gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa
tgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcata
taggtagggtttgattacactttgaaataacattattttacatgtaaatt
aatagtgtgacaatataacatgttcaaacagatgataaaaaagaattaga
atttagtgaatcaaagaagaaaaataggtcgcaaaacattaaaacttttg
gcctttggtgtaataatttgatggaaataacaaatcaaagatgtttatta
ttttgtgacatactatgccagatcataagatgttcgagattgcgtgataa
aactaaaagcatatgttttatatgattgtaacataatatgtcaattatcg
tagtctttgatactagaacataaagtagttgttatattagattgggatat
atgacacgctgtgcatgggatgtgtaggactgtcggaggagccagtgcaa
caagagaaggagatggtggggagcggagtagggatggcgtgggaggttgt
gacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaat
ataggaactgtagtgctggagggggtcataataatgatcataacgagggt
gtagacgacaaggacgacgacatggacgacatgaatgggcaggggaacgg
tggagga
back to top

gene from alignment at EU500503:1..1057+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500503.1-LFY ID=EU500503.1-LFY|Name=LFY|organism=Crataegus sp. 2001_29|type=gene|length=1057bp|location=Sequence derived from alignment at EU500503:1..1057+ (Crataegus sp. 2001_29)
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt tccaggcttatggggttagatactacacggcggcgaagatagcggagctt ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga aatgatgagcagcctctctcatatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa tgccctagatgctctctcccaagaaggtactatacgctatattatataca tgaatattatttacccttatgtcttagattaaccgtagtatataggcata taggtagggtttgattacactttgaaataacattattttacatgtaaatt aatagtgtgacaatataacatgttcaaacagatgataaaaaagaattaga atttagtgaatcaaagaagaaaaataggtcgcaaaacattaaaacttttg gcctttggtgtaataatttgatggaaataacaaatcaaagatgtttatta ttttgtgacatactatgccagatcataagatgttcgagattgcgtgataa aactaaaagcatatgttttatatgattgtaacataatatgtcaattatcg tagtctttgatactagaacataaagtagttgttatattagattgggatat atgacacgctgtgcatgggatgtgtaggactgtcggaggagccagtgcaa caagagaaggagatggtggggagcggagtagggatggcgtgggaggttgt gacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaat ataggaactgtagtgctggagggggtcataataatgatcataacgagggt gtagacgacaaggacgacgacatggacgacatgaatgggcaggggaacgg tggagga
back to top