LFY, EU500495.1-LFY (gene) Crataegus punctata

Gene Overview
NameLFY
Unique NameEU500495.1-LFY
Typegene
OrganismCrataegus punctata ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus punctatagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500495.1-LFY.m1Crataegus punctatamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500495.1
Alignments
Feature NameTypeLocationAnalysis
EU500495 region EU500495:1..1052+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500495.1-LFY ID=EU500495.1-LFY|Name=LFY|organism=Crataegus punctata|type=gene|length=1052bp
gaagcagccgtaacgccagtaccggcagctgctgcggcggcggctggtta
tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt
tccaggcttatggggttagatactacacggcggcgaagatagcggagctt
ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga
catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg
agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag
gaggaggactctcggcggcgcaaccttgtctctggtgataccaccatcaa
tgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcata
taggtagggtttgattacactttgaaataacattattttatatgtaaatt
aatagtgtgacaatataacatgttcaaacagaaaaaagaattagaattta
gtgaatcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctt
tggtgtactaatttgatggaagtaacaaatcaaagatgtttattattttg
tgacatactatgccagatcataagatgttcgagattgcgtgataaaacta
aaagcatatgttttatatgattgtaacataatatgtcaattatcgtagtc
tttgatactagaacataaagtagttgttatattagattgggatatatgac
acgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaaga
gaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacgg
cgggggagaggcggaagaagcagcggaggatgaagaaggggcaatatagg
aactgtagtgctggagggggtcataataatgatcataacgagggtgtaga
cgacaaggacgacgacatggacgacatgaatgggcaggggaacggtggag
ga
back to top

gene from alignment at EU500495:1..1052+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500495.1-LFY ID=EU500495.1-LFY|Name=LFY|organism=Crataegus punctata|type=gene|length=1052bp|location=Sequence derived from alignment at EU500495:1..1052+ (Crataegus punctata)
gaagcagccgtaacgccagtaccggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt tccaggcttatggggttagatactacacggcggcgaagatagcggagctt ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggaggactctcggcggcgcaaccttgtctctggtgataccaccatcaa tgccctagatgctctctcccaagaaggtactatacgctatattatataca tgaatattatttacccttatgtcttagattaaccgtagtatataggcata taggtagggtttgattacactttgaaataacattattttatatgtaaatt aatagtgtgacaatataacatgttcaaacagaaaaaagaattagaattta gtgaatcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctt tggtgtactaatttgatggaagtaacaaatcaaagatgtttattattttg tgacatactatgccagatcataagatgttcgagattgcgtgataaaacta aaagcatatgttttatatgattgtaacataatatgtcaattatcgtagtc tttgatactagaacataaagtagttgttatattagattgggatatatgac acgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaaga gaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacgg cgggggagaggcggaagaagcagcggaggatgaagaaggggcaatatagg aactgtagtgctggagggggtcataataatgatcataacgagggtgtaga cgacaaggacgacgacatggacgacatgaatgggcaggggaacggtggag ga
back to top