LFY, EU500490.1-LFY (gene) Mespilus germanica

Gene Overview
NameLFY
Unique NameEU500490.1-LFY
Typegene
OrganismMespilus germanica ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYMespilus germanicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500490.1-LFY.m1Mespilus germanicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500490.1
Alignments
Feature NameTypeLocationAnalysis
EU500490 region EU500490:1..689+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500490.1-LFY ID=EU500490.1-LFY|Name=LFY|organism=Mespilus germanica|type=gene|length=689bp
gaagcagccgtaacgccagcagcggcggctggttatacttttcggccgcc
aagagagcttggacttttagggcttgaagacttgttccaggcttatgggg
tcagatactacacggcggcgaagatagcggagcttggatttactgtgaac
accctcttggacatgaaggatgatgagcttgatgacatgatgagcagcct
ctctcagatattccgctgggagttgcttgttggggagaggtatggtatca
aagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcgg
cggcgcaaccttgtctctggtgataccaccaccaatgccctaaatgctct
ctcccaagaaggtactatacgctatatacatgaatattatatactagaac
ataaagtagtttgttatattagattgggatatatgatacgcggtgcatgg
gatgtgtagggctgtcagaggagccagtgcaacaagagaaggacatggtg
gggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcg
gaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctg
gagggggtcataacaatgatcataacgagggtgtagacgacaaggacgac
gacatggacgacatgaatgggcaggggaacggtggagga
back to top

gene from alignment at EU500490:1..689+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500490.1-LFY ID=EU500490.1-LFY|Name=LFY|organism=Mespilus germanica|type=gene|length=689bp|location=Sequence derived from alignment at EU500490:1..689+ (Mespilus germanica)
gaagcagccgtaacgccagcagcggcggctggttatacttttcggccgcc aagagagcttggacttttagggcttgaagacttgttccaggcttatgggg tcagatactacacggcggcgaagatagcggagcttggatttactgtgaac accctcttggacatgaaggatgatgagcttgatgacatgatgagcagcct ctctcagatattccgctgggagttgcttgttggggagaggtatggtatca aagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcgg cggcgcaaccttgtctctggtgataccaccaccaatgccctaaatgctct ctcccaagaaggtactatacgctatatacatgaatattatatactagaac ataaagtagtttgttatattagattgggatatatgatacgcggtgcatgg gatgtgtagggctgtcagaggagccagtgcaacaagagaaggacatggtg gggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcg gaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctg gagggggtcataacaatgatcataacgagggtgtagacgacaaggacgac gacatggacgacatgaatgggcaggggaacggtggagga
back to top