LFY, EU500479.1-LFY (gene) Crataegus dahurica

Gene Overview
NameLFY
Unique NameEU500479.1-LFY
Typegene
OrganismCrataegus dahurica ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus dahuricagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500479.1-LFY.m1Crataegus dahuricamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500479.1
Alignments
Feature NameTypeLocationAnalysis
EU500479 region EU500479:1..1040+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500479.1-LFY ID=EU500479.1-LFY|Name=LFY|organism=Crataegus dahurica|type=gene|length=1040bp
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggtta
tactttgcggccgccaagggagcttggaattggagggcttgaagacttgt
tccaggcttatggggttagatactacacgacggcgaagatagcggagctt
ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga
catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg
agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag
gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa
tgccctagatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattac
actttgaaataacattattttacatgtaaattaatagtgcgacaaaataa
catgttcaaacagatgataaaaaaaaaattagaatttagtgaatcaaaga
agaaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataat
ttgatggaaataacaaatcaaagatgtttattattttgtgacatactatg
ccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtt
ttatatgattgtaacataatatgtcaattatcgtagtctttgatactaga
acataaagtagttgttatattagattgggatgtatgacacgctgtgcatg
ggatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggt
ggggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggc
ggaagaaacagcggaggatgaagaaggggcaatataggaactgtagtgct
ggagggggtcataataatgatcataacgagggtgtagacgacaaggacga
cgacatggacgacatgaatgggcaggggaacggtggagga
back to top

gene from alignment at EU500479:1..1040+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500479.1-LFY ID=EU500479.1-LFY|Name=LFY|organism=Crataegus dahurica|type=gene|length=1040bp|location=Sequence derived from alignment at EU500479:1..1040+ (Crataegus dahurica)
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggaattggagggcttgaagacttgt tccaggcttatggggttagatactacacgacggcgaagatagcggagctt ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa tgccctagatgctctctcccaagaaggtactatgaatattatttaccctt gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattac actttgaaataacattattttacatgtaaattaatagtgcgacaaaataa catgttcaaacagatgataaaaaaaaaattagaatttagtgaatcaaaga agaaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataat ttgatggaaataacaaatcaaagatgtttattattttgtgacatactatg ccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtt ttatatgattgtaacataatatgtcaattatcgtagtctttgatactaga acataaagtagttgttatattagattgggatgtatgacacgctgtgcatg ggatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggt ggggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggc ggaagaaacagcggaggatgaagaaggggcaatataggaactgtagtgct ggagggggtcataataatgatcataacgagggtgtagacgacaaggacga cgacatggacgacatgaatgggcaggggaacggtggagga
back to top