MYBR14, HM122639.1-MYBR14.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122639.1-MYBR14.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
MYBR14MYBR14Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122639.1-MYBR14.m1-cds1HM122639.1-MYBR14.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MYBR14HM122639.1-MYBR14.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122639 region HM122639:281..1126+ NCBI Rosaceae gene and mRNA sequences
Chr13 chromosome Chr13:825324..828340- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr13 chromosome chr13:729065..732197- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductMYBR domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122639.1-MYBR14.m1 ID=HM122639.1-MYBR14.m1|Name=MYBR14|organism=Malus x domestica|type=mRNA|length=846bp
back to top

protein sequence of MYBR14

>HM122639.1-MYBR14.p1 ID=HM122639.1-MYBR14.p1|Name=MYBR14|organism=Malus x domestica|type=polypeptide|length=281bp
back to top

mRNA from alignment at HM122639:281..1126+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122639.1-MYBR14.m1 ID=HM122639.1-MYBR14.m1|Name=MYBR14|organism=Malus x domestica|type=mRNA|length=846bp|location=Sequence derived from alignment at HM122639:281..1126+ (Malus x domestica)
atgactacaagtagttgcagtgcaaggaacggcgctgttaggcagtatgt gagatccaaggtgcctcgtttgagatggactcctgagcttcatcgctgct ttcttcaggccatcgaaaggctcggaggccatagaaaggctactccaaaa cttgttcttcagttcatggatgtcaaagggctcaccatttctcatgtcaa aagccatctccagatgtatagaagcatgaaaggctacccgattagaagac aagatagggtgcaaacaagaaaactacattcgtttgaagaggccaaggat gatgggtgtgttgaagaagtaaatggtctgagcttttacccatcttccaa accaccagagaatccgattcccaggtcatctgcaacccccgccgttcaaa aagcaacaaccgagacgatgagttcaaacatatcagagaattcgcagccg cagcagcagctgcaatgcagccaaggaggaatatacgtgagagtctcaaa tccgtactcttttgatgattatatgctggcattgggaataaaggaggatc ctcacccttcagccttcaaatttgctttgccagagtctgagttcttgaag gttaccaccaaacaagaggcaggaagagcacatgccaaagacgatgacga agccagtgaatgtgaattatcactgtccctctcgttacaccatcccccct cccacaagagtaatgcttcttcaagtgacttaagtggtgcaatctcatcg tcctactctaggtctaactacaaagactgctccgcctcttcttccgggaa tcggagccttaatctgaatctttcgattgctctctgcagtaactga
back to top

Coding sequence (CDS) from alignment at HM122639:281..1126+

>HM122639.1-MYBR14.m1 ID=HM122639.1-MYBR14.m1|Name=MYBR14|organism=Malus x domestica|type=CDS|length=846bp|location=Sequence derived from alignment at HM122639:281..1126+ (Malus x domestica)
back to top