HSF8, HM122596.1-HSF8.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122596.1-HSF8.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
HSF8HSF8Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122596.1-HSF8.m1-cds1HM122596.1-HSF8.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
HSF8HM122596.1-HSF8.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122596 region HM122596:186..1337+ NCBI Rosaceae gene and mRNA sequences
Chr15 chromosome Chr15:5510688..5511956- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr15 chromosome chr15:2337891..2339159- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr15 chromosome chr15:2337892..2339160- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductHSF domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122596.1-HSF8.m1 ID=HM122596.1-HSF8.m1|Name=HSF8|organism=Malus x domestica|type=mRNA|length=1152bp
back to top

protein sequence of HSF8

>HM122596.1-HSF8.p1 ID=HM122596.1-HSF8.p1|Name=HSF8|organism=Malus x domestica|type=polypeptide|length=383bp
back to top

mRNA from alignment at HM122596:186..1337+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122596.1-HSF8.m1 ID=HM122596.1-HSF8.m1|Name=HSF8|organism=Malus x domestica|type=mRNA|length=1152bp|location=Sequence derived from alignment at HM122596:186..1337+ (Malus x domestica)
atggcgttgatgatagacaactgcgagggcatactgctctctctggactc ccacaagtcggtcccggcgccgttcctgaccaaaacctaccagctcgtcg acgaccccgccaccgaccacatcgtctcgtggggcgacgacgacaccacc ttcgtcgtctggcgccctcccgagttcgcccgcgacctcctccccaacta cttcaagcacaacaacttctcaagcttcgtccgccagctcaacacctatg gttttaggaagattgtaccggacagatgggagtttgcgaacgagttcttc aaaaagggagagaagcatttgctttgcgagatccaccggagaaaaacagc tcagccacatcaggtgggtctcagccaccaccaccaccaccactcccaac tcggcatgaacggccaccaccaccatcctggctttttccccttcccaagt cccggcagcatctcgccctccgactcggacgagcagcccaactggtgcga ttcggactcccctcctctcttatccccaacgggaggtattaacacaaaca ttaactctaacaacaataatttcatgaatattaacaataataataccacg gtggcgggtttggcggaggacaacgagaggctgcggaggagcaacaccat gctaatgtctgagctggcacatatgagaaaactctacaacgacatcatct actttgttcagaaccatgtcaagccggtggctccgagcaactcataccct tcttccatgcttctctgcaacccacagcctcctaaacataatggtcctaa tagtaatttgaaccaacttctagggtactatccggctgctcctccaccta atgccaaacaaaaccctcatcatatcatgaactcttccagtccgatgagc aacaccacgtcgaagagctcctccgtcactattctcgaagaccatcacca gcagcctccgagcggtaacaatgggtgcaagaacactaagctttttgggg tgccgctgcttcattcgaagaaacgattgcacccggaggagtacggctcg aataatcaccatgggaacaacatgatggaggccagcaaggctcgtttgat tttggagaaggatgatttaggactccacctcatgcctccatccagatgtt ag
back to top

Coding sequence (CDS) from alignment at HM122596:186..1337+

>HM122596.1-HSF8.m1 ID=HM122596.1-HSF8.m1|Name=HSF8|organism=Malus x domestica|type=CDS|length=1152bp|location=Sequence derived from alignment at HM122596:186..1337+ (Malus x domestica)
back to top