HSF1, HM122589.1-HSF1.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122589.1-HSF1.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
HSF1HSF1Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122589.1-HSF1.m1-cds1HM122589.1-HSF1.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
HSF1HM122589.1-HSF1.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122589 region HM122589:176..1420+ NCBI Rosaceae gene and mRNA sequences
Chr16 chromosome Chr16:1246392..1248406- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr10 chromosome chr10:1456139..1458153+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr10 chromosome chr10:1789383..1791397+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductHSF domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122589.1-HSF1.m1 ID=HM122589.1-HSF1.m1|Name=HSF1|organism=Malus x domestica|type=mRNA|length=1245bp
back to top

protein sequence of HSF1

>HM122589.1-HSF1.p1 ID=HM122589.1-HSF1.p1|Name=HSF1|organism=Malus x domestica|type=polypeptide|length=414bp
back to top

mRNA from alignment at HM122589:176..1420+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122589.1-HSF1.m1 ID=HM122589.1-HSF1.m1|Name=HSF1|organism=Malus x domestica|type=mRNA|length=1245bp|location=Sequence derived from alignment at HM122589:176..1420+ (Malus x domestica)
atggtgaaatcggcggagaagggcggaggagatgggtctgggccgtcggg gtcggtgcctccttttctcagaaaatgctacgagatggtggatgacaagg acagcgacagtataatctcgtggagtgaagccggcgacagctttgcgata ctggacatggcccagttctcgatttcaatgctgcccaagtatttcaagca cagcaacttttctagcttcatgaggcagctcaatatctatggatttagaa aaatagatccagatcgttgggtgtttgcaaatgaaggatttattcgaggt caaaagcatttgttgaagaatattgctagaaggaaacatccacagggcac agatcaaaaaaagatattacagcaaaaagacaatcctgatataccgtctg aaaatattagtgaaaatggtctgtggaaggaagttgagaacttgaagact gataaagttgctctgaagcaagagttggtgaagcttaggcagcaccagga aatttcacaaaataaattgctcctcctgaggaaccgccttcgcggaatgg agaaaaatcaacagcagatgctgtcatttctagtgatggccatgcaaagt cctggatttctagttcagcttcttcatccaaaggaaaatagttggcgaat tgctgaagctggcaatataatagaacagtgtatggatgatgatagaccag tggcttctgatggtgcgatagtgaggtaccaaccaccgatgattgaagcc ccaaagcctttagtcccaccgaattcaggctcagagaaacaacctgaagt tgatgcttatatggatggaatggaagattttgttgtaaatcctgatttca tgaaaatgctaatggatgaaaagttgagccctgtagaaacccatgcccca tatactctaccagatatatctgacgatggtgcatgggagcagtttctttt agctagtcctttcttagaaaatattgaaggtacaaaggaagatggcgaag agcctgctgatgctagaatggaggtggaaccaatagtatctgatctggat gaatcacaaaattttgattatttagtcgagcaaatgaagaaatctcagaa ctttgcatcggattcaacagttgatggatctaatatggagagctctcaaa acttggagtttattactgaacaaatgggacatttggcttctgactctaac aacatggaacagaatcagggaagcagaaggacaacttctgtgtaa
back to top

Coding sequence (CDS) from alignment at HM122589:176..1420+

>HM122589.1-HSF1.m1 ID=HM122589.1-HSF1.m1|Name=HSF1|organism=Malus x domestica|type=CDS|length=1245bp|location=Sequence derived from alignment at HM122589:176..1420+ (Malus x domestica)
back to top