S-RNase, EF653137.1-S-RNase (gene) Prunus humilis

Gene Overview
NameS-RNase
Unique NameEF653137.1-S-RNase
Typegene
OrganismPrunus humilis ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S-RNaseS-RNasePrunus humilisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
S-RNaseEF653137.1-S-RNase.m1Prunus humilismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEF653137.1
Alignments
Feature NameTypeLocationAnalysis
EF653137 region EF653137:1..270+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EF653137.1-S-RNase ID=EF653137.1-S-RNase|Name=S-RNase|organism=Prunus humilis|type=gene|length=270bp
tcaccattcatggcctatggccaagtaattattcaaagtacccttgggtg
gctaattgccctgggacgccatttaacaatagtttggtatggattgtttt
gttttgttttctagttactctctagtttttgtattttcctcacaatatat
ttgttgcttggatgtctcagtccccaagaattgaaaccaaactgaagata
tcttggcccaacgtggaaaatggcaataatacagaattttggggacgtga
atggaacaaacacggtacat
back to top

gene from alignment at EF653137:1..270+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF653137.1-S-RNase ID=EF653137.1-S-RNase|Name=S-RNase|organism=Prunus humilis|type=gene|length=270bp|location=Sequence derived from alignment at EF653137:1..270+ (Prunus humilis)
tcaccattcatggcctatggccaagtaattattcaaagtacccttgggtg gctaattgccctgggacgccatttaacaatagtttggtatggattgtttt gttttgttttctagttactctctagtttttgtattttcctcacaatatat ttgttgcttggatgtctcagtccccaagaattgaaaccaaactgaagata tcttggcccaacgtggaaaatggcaataatacagaattttggggacgtga atggaacaaacacggtacat
back to top