LFY, DQ073632.1-LFY (gene) Rubus parvifolius var. taquetii

Gene Overview
NameLFY
Unique NameDQ073632.1-LFY
Typegene
OrganismRubus parvifolius var. taquetii ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYRubus parvifolius var. taquetiigene


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ073632.1
Alignments
Feature NameTypeLocationAnalysis
DQ073632 region DQ073632:1..570+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ073632.1-LFY ID=DQ073632.1-LFY|Name=LFY|organism=Rubus parvifolius var. taquetii|type=gene|length=570bp
aaaccgggcatctttttttgttgtttttattttggctaagaagcctgtag
gttgtacgccagccatatgtagcttgaactgtgatggccacaatgcttag
ctattgccggtacccaagacgcctttggttgaatgttcacacctgatcca
ccgtctgcacttcctacattcactcccggaaattgaaacaggaaaatggg
aattgtaacctcccggtctgctgtagtcagcctcagggtgtgcctgactg
gcgagtccgccgtctccacggcttcccggctgctcctcaagccttcgagt
gccgatcttcgcttgggccgtctcgcgaagatcttcgatccgcatctact
ctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgatc
gaagagagctatcgctcagccgcttcgcgtattacttatgaaagccgtat
tgcccgaagggggcatgctgcaagagcgtaggtgagtggtaagcgtagga
ggcgtgcccgaagggcagcggcagcagtgtggttccaggtgccgtcgcta
gattgagatccgcagggtgg
back to top