LFY, DQ073625.1-LFY (gene) Rubus crataegifolius

Gene Overview
NameLFY
Unique NameDQ073625.1-LFY
Typegene
OrganismRubus crataegifolius ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYRubus crataegifoliusgene


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ073625.1
Alignments
Feature NameTypeLocationAnalysis
DQ073625 region DQ073625:1..571+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ073625.1-LFY ID=DQ073625.1-LFY|Name=LFY|organism=Rubus crataegifolius|type=gene|length=571bp
aaaccgggcatctttttttcttttttttttttttggctaagaagcctgta
ggttgtacgccagccatatgtagcttgaactgtgatggccacaatgctta
gctattgccggtacccaagacgcctttggttgaatgttcacacctgatcc
accgtctgcacttcctacattcactcccggaaatttaaacaggaaaacgg
gaattgtaatctcccggtctgctgtagtcagcctcagggtgtgcctgact
ggcgagtctgccgtctccacggcttcccggctgctcctcaagccttcgag
tgccgatcttcgcttgggccgtctcgcgaagatcttcgatccgcatctac
tctctcttagaggatgaaccacgccttcgctatcgaaagaatatagcgat
cgaagagagctatcgctcagccgcttcgcgtattacttacgaaagccgta
ttgcccgaagggggcatgctgcaagagcgtaggtgagtggtaagcgtagg
aggcgtgcccgaagggcagcggcagcagtgtggttccaggtaccgtcgct
agattgagatccgcagggtgg
back to top