LFY, DQ073618.1-LFY (gene) Rubus pungens var. oldhamii

Gene Overview
NameLFY
Unique NameDQ073618.1-LFY
Typegene
OrganismRubus pungens var. oldhamii ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYRubus pungens var. oldhamiigene


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ073618.1
Alignments
Feature NameTypeLocationAnalysis
DQ073618 region DQ073618:1..575+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ073618.1-LFY ID=DQ073618.1-LFY|Name=LFY|organism=Rubus pungens var. oldhamii|type=gene|length=575bp
aaaccgggcatctttttttgttgtttttattttggctaagaagcctgtag
gttgtacgccagccatatgtagcttgaactgtgatggccacaatgcttag
ctattgccggtacccaagacgcctttggttgaatgttcacacctgatcca
ccgtctgcacttcctacattcactcccggaaattgaaacaggaaaacggg
aattgtaacctcccggtctgctgtagtcagcctcagggtgtgcctgactg
gcgagtctgccgtctccacggcttcccggctgctcctcaagccttcgagt
cgagtgccgatcttcgcttgggccgtctcgcgaagatcttcgatccgcat
ctactctctcttagaggatgaaccacgccttcgctatcgaaagaatatag
cgatcgaagagagctatcgctcagccgcttcgcgtattacttacgaaagc
cgtattgcccgaagggggcatgctgcaagagcgtaggtgagtggtaagcg
taggaggcgtgcccgaagggcagcggcagcagtgtggttccaggtgccgt
cgctagattgagatccgcagggtgg
back to top