BZIP6, HM122480.1-BZIP6.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122480.1-BZIP6.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BZIP6BZIP6Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122480.1-BZIP6.m1-cds1HM122480.1-BZIP6.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BZIP6HM122480.1-BZIP6.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122480 region HM122480:566..1045+ NCBI Rosaceae gene and mRNA sequences
Chr10 chromosome Chr10:9679445..9679924+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr8 chromosome chr8:2303356..2303835+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr8 chromosome chr8:2676725..2677204+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductBZIP domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122480.1-BZIP6.m1 ID=HM122480.1-BZIP6.m1|Name=BZIP6|organism=Malus x domestica|type=mRNA|length=480bp
back to top

protein sequence of BZIP6

>HM122480.1-BZIP6.p1 ID=HM122480.1-BZIP6.p1|Name=BZIP6|organism=Malus x domestica|type=polypeptide|length=159bp
back to top

mRNA from alignment at HM122480:566..1045+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122480.1-BZIP6.m1 ID=HM122480.1-BZIP6.m1|Name=BZIP6|organism=Malus x domestica|type=mRNA|length=480bp|location=Sequence derived from alignment at HM122480:566..1045+ (Malus x domestica)
atggcttcctccagtgggacatcttcaggctcctcctccatgattcatca aaattcatgctctgaggaagacttgacggctctgatggaccagagaaaga ggaagagaatgatttccaaccgcgaatcggccaggcggtctaggatgagg aagcagaagcacttggatgatctgacgggccagatcagccagctacagaa ggacaacgaacagatcatctccggcctcaacatcacaagccagcattaca tgaacgttgaggcagagaactctgttctcagagcccaagctgatgagctc agcaacagattgcagtccctcaatgagattgccagtttcttgaatgcaaa caatggggggctccatgcagctgcagcagattcaagctgcttcgctgagc ctcatgacagcttcttcaaccctttgaatctgtcatatcttaatcagcct ataatggcctctgcagagatgttctactga
back to top

Coding sequence (CDS) from alignment at HM122480:566..1045+

>HM122480.1-BZIP6.m1 ID=HM122480.1-BZIP6.m1|Name=BZIP6|organism=Malus x domestica|type=CDS|length=480bp|location=Sequence derived from alignment at HM122480:566..1045+ (Malus x domestica)
back to top