BZIP4, HM122477.1-BZIP4.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122477.1-BZIP4.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BZIP4BZIP4Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122477.1-BZIP4.m1-cds1HM122477.1-BZIP4.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BZIP4HM122477.1-BZIP4.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122477 region HM122477:279..749+ NCBI Rosaceae gene and mRNA sequences
Chr08 chromosome Chr08:1861739..1862209- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr8 chromosome chr8:1641214..1641684+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr8 chromosome chr8:1614882..1615352- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductBZIP domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122477.1-BZIP4.m1 ID=HM122477.1-BZIP4.m1|Name=BZIP4|organism=Malus x domestica|type=mRNA|length=471bp
back to top

protein sequence of BZIP4

>HM122477.1-BZIP4.p1 ID=HM122477.1-BZIP4.p1|Name=BZIP4|organism=Malus x domestica|type=polypeptide|length=156bp
back to top

mRNA from alignment at HM122477:279..749+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122477.1-BZIP4.m1 ID=HM122477.1-BZIP4.m1|Name=BZIP4|organism=Malus x domestica|type=mRNA|length=471bp|location=Sequence derived from alignment at HM122477:279..749+ (Malus x domestica)
atggcttcttcaagcggaaattcctctggttccactcagcttcagaactc tggctccgaaggggatctgcatcatctggtggatcaaagaaagagaaaac ggatgcagtcgaaccgcgaatcggcgcggcggtcccggatgcggaagcag cagcacctggacgatctgacggcgcaggtcgcccagctgcggaaggagaa caaccaaatcctgaccagcataaacatcaccacccagcaccacatgaatg tcgagtcggaaaactcggttttgaaagcgcagatggcggagctcagccag agactggagtcactcaacgagatcctaggttacatcgacgccggcggcgg ttacggcggagactttgaaaccaccccggttgccgatcacaacagcttca taaacccttggaacatgctttatgttaaccaaccaatcatggccactgcc gacatgcttcaccaatactaa
back to top

Coding sequence (CDS) from alignment at HM122477:279..749+

>HM122477.1-BZIP4.m1 ID=HM122477.1-BZIP4.m1|Name=BZIP4|organism=Malus x domestica|type=CDS|length=471bp|location=Sequence derived from alignment at HM122477:279..749+ (Malus x domestica)
back to top