BZIP21, HM122474.1-BZIP21.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122474.1-BZIP21.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BZIP21BZIP21Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122474.1-BZIP21.m1-cds1HM122474.1-BZIP21.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BZIP21HM122474.1-BZIP21.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122474 region HM122474:251..1297+ NCBI Rosaceae gene and mRNA sequences
chr2 chromosome chr2:13282227..13285109+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Property NameValue
ProductBZIP domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122474.1-BZIP21.m1 ID=HM122474.1-BZIP21.m1|Name=BZIP21|organism=Malus x domestica|type=mRNA|length=1047bp
back to top

protein sequence of BZIP21

>HM122474.1-BZIP21.p1 ID=HM122474.1-BZIP21.p1|Name=BZIP21|organism=Malus x domestica|type=polypeptide|length=348bp
back to top

mRNA from alignment at HM122474:251..1297+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122474.1-BZIP21.m1 ID=HM122474.1-BZIP21.m1|Name=BZIP21|organism=Malus x domestica|type=mRNA|length=1047bp|location=Sequence derived from alignment at HM122474:251..1297+ (Malus x domestica)
atggggacaggggaagaaggtactcctcctaagccttccaaacaagcttc aacagctcaggaaataccaacaccaccttcgtatcccgattggtccagct ctatgcaggcttattatggtcctggtggtactccgcctccctttttcgcc tccactgttgcttccccaactccacacccttatatgtggggagcccagca tcctatgatgccgccatatggaactccagttccatatccggccatgtatc ctccaggtggagtttatgctcatcctagtatggtcacgactccaggcgca ccacaaccagccccggagttggaagggaagggttctgatgggaaagagcg ggcttcaactaaaaagaccaagggaactgcaggaaatgcaagtttggctg gtggcaaggctgtggagagtggaaaggcaacttcaggttcaggaaatgat ggtgcttcacaaagtggtgaaagtggtagcgagggttcctctgatggaag tgatgataatgctaaccatcaggagtatggtacaaacaagaaggggagct ttgacaagatgcttgccgatggtgcaaatgcacagaatagcactggggcc attcaggcttcagtgcctgggaagcctgtctctatgcctggaactaatct gaatattggaatggacttatggaatgcatcccctgctggtgctggagcag caaaagtgagaggaaatccgtcgggtgccccatcagctggtggtgagcat tggattcaagacgaacgtgaactgaaaagacagaaaagaaagcaatcgaa tagggagtcagctaggaggtcaagattacggaagcaggctgagtgtgaag agctacaagcaagggtagaggttttgagcaatgagaatcatggcctcaga gaggagctgcacaggctttctgaggaatgtgagaaacttacatcagagaa tactaatataaaggaagaattgacacgagtgtgcggacctgatttagtag caaaccttgagcagcagcctggtggtggtgagggcaaaaacagctga
back to top

Coding sequence (CDS) from alignment at HM122474:251..1297+

>HM122474.1-BZIP21.m1 ID=HM122474.1-BZIP21.m1|Name=BZIP21|organism=Malus x domestica|type=CDS|length=1047bp|location=Sequence derived from alignment at HM122474:251..1297+ (Malus x domestica)
back to top