BZIP18, HM122470.1-BZIP18.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122470.1-BZIP18.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BZIP18BZIP18Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122470.1-BZIP18.m1-cds1HM122470.1-BZIP18.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BZIP18HM122470.1-BZIP18.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122470 region HM122470:121..2646+ NCBI Rosaceae gene and mRNA sequences
Chr15 chromosome Chr15:6405717..6411837- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr3 chromosome chr3:28402800..28408886- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr3 chromosome chr3:33393316..33399402+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
ProductBZIP domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122470.1-BZIP18.m1 ID=HM122470.1-BZIP18.m1|Name=BZIP18|organism=Malus x domestica|type=mRNA|length=2526bp
back to top

protein sequence of BZIP18

>HM122470.1-BZIP18.p1 ID=HM122470.1-BZIP18.p1|Name=BZIP18|organism=Malus x domestica|type=polypeptide|length=841bp
back to top

mRNA from alignment at HM122470:121..2646+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122470.1-BZIP18.m1 ID=HM122470.1-BZIP18.m1|Name=BZIP18|organism=Malus x domestica|type=mRNA|length=2526bp|location=Sequence derived from alignment at HM122470:121..2646+ (Malus x domestica)
atggctgtgacgtcttcctgcaaagatggtgggatgaagatgcagatgga caatggcaagtacgtaaggtacacgccggagcaagtggaagctttagagc ggttgtaccatgagtgcccgaagccgagctccatgcgccgccagcagctc atccgcgagtgccctatcctctccaacatcgagccgaagcagatcaaagt ttggttccaaaaccgcagatgcagagagaagcagcgcaaggaggcgtcga gattgcagacggtgaacagaaagctgacggcgatgaacaagcttctgatg gaggagaatgatcggttgcagaagcaggtttctcagctggtctatgagaa cacctatttccgccagcacacacaaaatgcaactctagcgacgacagaca cgagttgtgagtcggtggtgacgagcggtcaacaccatttgactgcacag cagcatccaccaccaagggatgccagccctgcaggacttctgtccattgc acaggaaactttagcagagtttttatcaaaggccactgggactgctgtgg agtgggtccaattgcctgggatgaagcctggtccggattccattggaatc gttgcaatttctcacggttgcactggtgtggcagcacgtgcatgcggcct tgtaggtctagaccctacaagagtcgctgaaatcctcaaagatcggcctt cgtggttccgaaattgccgatctgtggatgtggccaatgtaatgtccact ggcaatggtggaaccattgaactgctttacatgcagctctatgcacccac gactttggcaccagctcgagacttctggttgcttcgctacacatcggttc tagaagacggtagtcttgtggtctgtgaaagatcacttaacaacacacag aatggtcctagcatgccaccagtgcagaattttgtgagagcggaaatgct gccgagcgggtatctaattagaccttgtgaaggtggtggctcgatccttc acattgttgatcatatggatttagagccttggagtgtacctgaagtgttg cgcccgctttatgagtcatcaacaattcttgctcagaagacaactatggc agcattacgcaacctgaggcagatatctcaagaagtttctcagcctaatt ctgctggttggggaagaaggcctgcagctctccgtgctcttagtcagaga ttgagcaagggtttcaatgaagcagttaacgggtttacagatgagggatg gtctgttctagaaagtgatggtgtcgatgatgttacccttcttgtgaact cgtctccgggcaagatgatgagtgcaaatctttataccgatggagttcca tctatgagcactgcagtcttatgtgccaaagcatccatgttactccaaaa tgtgcctccagccatccttctcagattcttgcgagaacaccgatcagagt gggctgacagaagcattgatgcttattcagctgctgctgttaaagctggt ccctgcaacatgctagggcctcgagttggaagtttcggggataatgttat tcttcccctggctcacacaattgagcacgaagagttcatggaggtcatta agattgagaacttgggccactatcgagaggatatgattatgcctgcagct gacattttcctcttgcaactgtgtagtggagtggatgagaatgccgtcgg gacctgctctgaactagtatttgctcccatcgatgcatcattttcggatg atgctccaattctaccttctggtttccggatcatccctcttgattctcgg atggatactcccagtccaaaccgtacacttgatctggcctcagctcttga agttggacccgcaggaagcagagcatctggtgataatgctggccactctg gcaatacaaagtccgtaatgacaatagcattccagtttgcatttgaaatt cacctacaagaaaatgtagcctccatggctcggcagtatgtgcgcagtat catagcatcagtgcagagggtggcactggcgctctccccttctcgttttg gttctcatgctggtttccggcctccacctggcactccccaagcacaaaca cttgctggttggatttgtcagagctataggtgctatctaggtggagaact actaaaaaccgaaggaagcgagtccattctcaaatccctttggcatcacc cggatgcaatcttatgctgctctttgaaggcaatgccaatttttacattc ggaaaccaggcaggcctggacatgcttgagacgacgttagttgcacttca agacattacgctggaaaagattttcgatgacaatggaaggaagacactat gctccgagttcccgcagataatgcagcagggttttatgtgtcatcaagga ggaatatgcatgtcaagcatgggaaggccgatctcgtacgagagagcggt agcatggaaggtgctgaatgaagaagaaaccgctcactgcatctgcttca tgttcatcaactggtcatttgtttaa
back to top

Coding sequence (CDS) from alignment at HM122470:121..2646+

>HM122470.1-BZIP18.m1 ID=HM122470.1-BZIP18.m1|Name=BZIP18|organism=Malus x domestica|type=CDS|length=2526bp|location=Sequence derived from alignment at HM122470:121..2646+ (Malus x domestica)
back to top