BZIP17, HM122469.1-BZIP17.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameHM122469.1-BZIP17.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BZIP17BZIP17Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122469.1-BZIP17.m1-cds1HM122469.1-BZIP17.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BZIP17HM122469.1-BZIP17.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HM122469 region HM122469:1..1734+ NCBI Rosaceae gene and mRNA sequences
Chr11 chromosome Chr11:4400378..4403395+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr11 chromosome chr11:4534543..4537562+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr11 chromosome chr11:4536564..4539841- Malus x domestica Whole Genome v1.0 Assembly & Annotation
Property NameValue
ProductBZIP domain class transcription factor
The following sequences are available for this feature:

mRNA sequence

>HM122469.1-BZIP17.m1 ID=HM122469.1-BZIP17.m1|Name=BZIP17|organism=Malus x domestica|type=mRNA|length=1734bp
back to top

protein sequence of BZIP17

>HM122469.1-BZIP17.p1 ID=HM122469.1-BZIP17.p1|Name=BZIP17|organism=Malus x domestica|type=polypeptide|length=577bp
back to top

mRNA from alignment at HM122469:1..1734+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122469.1-BZIP17.m1 ID=HM122469.1-BZIP17.m1|Name=BZIP17|organism=Malus x domestica|type=mRNA|length=1734bp|location=Sequence derived from alignment at HM122469:1..1734+ (Malus x domestica)
atggcttcccctctcaatggcagcaacaggctctcccttgccatggagcg cactggccaatggattttctcccaagatatcccgtcagatgttgtggttc aagttggtgaagccaatttctctctacacaagttcatgcttgtggcgaaa agcaaccgcataaggaagctgataatggagtctaaaaaaccggacctaac gagaatcgacctctccgacgttcccggaggcccggagacgttcgagaagg cggccaagttctgctacggcgtcaacttcgagatcacagtccacaacgtc gccgccctccgttgcgcggcggagtatttggaaatgaccgaaaagtactg cgacaacaacctcaccggccgcactgaagatttcttatctcaagtcgctc tcatgagcctctccggcgccattgtcgtgctcaagtcctgcgaagatctc cttcccatggcggaggacctcaaaatcgtacagaaatgcgtcgatgtcgc cgcttccaaggcctcaatcgaagcaaaatttccgagtcgatcgccgacga attggtggacagaggaattgtcgattttggacattgagttcttcggcaga gttatctccgtgatgaagctacgcggcgggaaatcattgaccgtttccag cgctatcataacttacgctgagaaatggctccgagatatcgtccgagacc gctctggacccgccgcgaaattggccgcttcggacgactccgatctgcga ctccaacaacgggagctgctggaatcgatcgtcgcgatcttaccgactga gaaagctgcaatgccgatcaacttcctctgctgccttctcagatctgcga ccttcgtcaaggcgtcgagcacgtgcaagaccgagctcgagaggcggatc tcgtcggtcctggagcacgtgaccgtcgacgacctcctggtgctgtcgtt cacctacgacggcgagaggctgttcgatctcgagagcgtgaggaggatta tctccgggttcgtggagaaggagaagagcgtcgcggtcttcaacgccggc gatttcagggaggtttgctcggcggagatgatcagagtcgcgaagactgt cgacgcgtatcttggtgagatcgccacgtgtgttgagctcagtatctcga agttcaatggcattgccaacctcatccccaagggcgcgcgtaaagtcgac gatgatctctatcgtgccattgatatttacttgaaggcccatccgaacct tgatgagatagagagggagaaggtgtgcagcgtaatggacgcattgaagt tgtcatacgaagcgagagtccacgcttcacaaaacaaacgactccccgtt caaatcgtactgcacgcgttgtattacgaccagctaaagctgaggagcgg ggtggacgaaaacgacgtgcaagatgcaataacgacgaggagtcgggtgc aacacgacgtgtcgttggcgagggagaacgaggagttgagaacggagttg ttgaagatgaagatgtacattacggacatgcagaagactggctctgcagg gattgcaacgacgtcgtctggtaaaggaggtggcgggcccaaaaaggcca catttttctcgtctgtgtcgaagaaattggggaagttgaatcccttcaag caagggtcgaaggacacatcgaatatcatagatgatggtgtggatatttc caagcctagaaggagaaggttttctatttcttaa
back to top

Coding sequence (CDS) from alignment at HM122469:1..1734+

>HM122469.1-BZIP17.m1 ID=HM122469.1-BZIP17.m1|Name=BZIP17|organism=Malus x domestica|type=CDS|length=1734bp|location=Sequence derived from alignment at HM122469:1..1734+ (Malus x domestica)
back to top