GLU, U49454.1-GLU (gene) Prunus persica

Gene Overview
NameGLU
Unique NameU49454.1-GLU
Typegene
OrganismPrunus persica (Peach)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUGLUPrunus persicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GLUU49454.1-GLU.m1Prunus persicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreU49454.1
Alignments
Feature NameTypeLocationAnalysis
PPU49454 region PPU49454:1530..2742+ NCBI Rosaceae gene and mRNA sequences
scaffold_7 supercontig scaffold_7:8592336..8593548- Prunus persica Whole Genome v1.0 Assembly & Annotation
scaffold_7 supercontig scaffold_7:8581255..8582563- Prunus persica Whole Genome v1.0 Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>U49454.1-GLU ID=U49454.1-GLU|Name=GLU|organism=Prunus persica|type=gene|length=1213bp
atgactaaatcgaattcgtcatcagttggcagactcctttctctgatttc
catagtacttctacttgggcagctggtggtgggtagcttggcaacaaaac
aacacacaggtatgcatatataattggcacctctgtcaatctaactgcaa
attacgacatttttgtgtgtgtctattttaaagataaggaccaaactgtt
ccatgcaacaaaccacgcatttctaatcaatctcacatgtaagcaatatt
aattcctttttcaatgtaggtgctccaattggtgtatgtaatggaatggt
tggcgatgacctaccaccccaagcagaagttgttgccctctacaagacaa
ataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa
gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaa
ccttcaatacattgccttaagccaagccaacgcaaatgcatgggtccaaa
acaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtagga
aatgaagtcaagccttcagactcctttgcacagtttctcgtcccagccat
gcgaaatattcaagaggcaatttctcttgctggtcttgcaaagaaaatta
aagtttcgacagccatcgacaccggagtacttggagagacctttcctcct
tcgataggctcattcaagtctgaatataacgcccttttatatcccatcat
ccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt
attttgcttacagtggcaacactcaagacattcgtcttgactatgctctt
ttcacagctccatcagttgtggtacaagatgggaactttggttaccgaaa
tcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctg
gtggagggtctttgaaagttgttatatcagagactggttggccatcagct
gctggaacagccacaacaattgataatgcaaggacttttatatcaaattt
gattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatag
aaacttacatctttgccatgtttgatgagaatagaaagaccccagagctt
gagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat
cagtttcaattga
back to top

gene from alignment at PPU49454:1530..2742+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>U49454.1-GLU ID=U49454.1-GLU|Name=GLU|organism=Prunus persica|type=gene|length=1213bp|location=Sequence derived from alignment at PPU49454:1530..2742+ (Prunus persica)
atgactaaatcgaattcgtcatcagttggcagactcctttctctgatttc catagtacttctacttgggcagctggtggtgggtagcttggcaacaaaac aacacacaggtatgcatatataattggcacctctgtcaatctaactgcaa attacgacatttttgtgtgtgtctattttaaagataaggaccaaactgtt ccatgcaacaaaccacgcatttctaatcaatctcacatgtaagcaatatt aattcctttttcaatgtaggtgctccaattggtgtatgtaatggaatggt tggcgatgacctaccaccccaagcagaagttgttgccctctacaagacaa ataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaa ccttcaatacattgccttaagccaagccaacgcaaatgcatgggtccaaa acaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtagga aatgaagtcaagccttcagactcctttgcacagtttctcgtcccagccat gcgaaatattcaagaggcaatttctcttgctggtcttgcaaagaaaatta aagtttcgacagccatcgacaccggagtacttggagagacctttcctcct tcgataggctcattcaagtctgaatataacgcccttttatatcccatcat ccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt attttgcttacagtggcaacactcaagacattcgtcttgactatgctctt ttcacagctccatcagttgtggtacaagatgggaactttggttaccgaaa tcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctg gtggagggtctttgaaagttgttatatcagagactggttggccatcagct gctggaacagccacaacaattgataatgcaaggacttttatatcaaattt gattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatag aaacttacatctttgccatgtttgatgagaatagaaagaccccagagctt gagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat cagtttcaattga
back to top