LFY1, GU991465.1-LFY1 (gene) Malus x domestica

Gene Overview
NameLFY1
Unique NameGU991465.1-LFY1
Typegene
OrganismMalus x domestica (Apple)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Malus x domesticagene


Cross References
External references for this gene
DatabaseAccession
nuccoreGU991465.1
Alignments
Feature NameTypeLocationAnalysis
GU991465 region GU991465:1..642+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU991465.1-LFY1 ID=GU991465.1-LFY1|Name=LFY1|organism=Malus x domestica|type=gene|length=642bp
tggacgttcatcaataaagaaaaagactcttatactcatgtataaaatta
ccacaaagacttggtgattgtctaagaaaaacagttatggggtttttttt
cactgtattcaccgcattgatgcaccttgttggtatgcactggaaactta
ggtagttgaccgtaaacgttatctatacactcatttttacctttcacaca
tcattctcaatttatggtcgttggatcgaataaattgaaaaagatcaatt
gaccaaaattaataagaatgtgtcaaagataaatagatgtgtgtgaaaag
cactactaaaagcacttctttccagtatgaacaacacattttcaatcaat
ttagatttggcaaagtttcacttttgtttatgtattttcgattacatcga
atttaatacaagcggtctgcaaattttgtcaatttaagaatatccgtcta
cttccgtgaatttcttgcatgaaatctattaaatttatcctcatacaaga
aatttacattgttgatgaatattctttgaattggaactactttcttacat
catgagtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcag
tttgtagtccaaataaatttgattcgactatttaggtcgact
back to top