LFY1, GU991436.1-LFY1 (gene) Pyrus pashia

Gene Overview
NameLFY1
Unique NameGU991436.1-LFY1
Typegene
OrganismPyrus pashia ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Pyrus pashiagene


Cross References
External references for this gene
DatabaseAccession
nuccoreGU991436.1
Alignments
Feature NameTypeLocationAnalysis
GU991436 region GU991436:1..649+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU991436.1-LFY1 ID=GU991436.1-LFY1|Name=LFY1|organism=Pyrus pashia|type=gene|length=649bp
tggacgttcatcaataaagaaaaagactattatactcatatataaaatta
ccacaaagacttggtgattgtctaagaaaaacaattatggggtttttttc
actgtattcacctcattgatgcaccttgttgttatggtatgcactagaaa
cttaggtagttgaaccctaagcattatctacacactcatttttacctctc
acacatcattctcaattcatggccgtcatatcgaatgaattgaaaaagat
caattgaccaaaattaataagaatgtgttagagataaaaagatgtgtgtg
aaaaacactactaaaagcacttctttccggttatgaacaacacattttca
atcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgttgaatttaatacatgcggtctgaaaattttgtcaatttaagaatatc
cgtcaacttccgtgaatttcttgtatgaaatctgttaaatttatcctcgt
ataagaaatttacattgttgatgaatattctttgaattggaactactttc
ttacatcatgagtcaaatttgatgcaatcgaaaatacatgaatgaaagta
ggtcagtttgtagtccaaaagtaatttgattcaactatttagttcgact
back to top