LFY1, GU991429.1-LFY1 (gene) Pyrus amygdaliformis

Gene Overview
NameLFY1
Unique NameGU991429.1-LFY1
Typegene
OrganismPyrus amygdaliformis ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFY1LFY1Pyrus amygdaliformisgene


Cross References
External references for this gene
DatabaseAccession
nuccoreGU991429.1
Alignments
Feature NameTypeLocationAnalysis
GU991429 region GU991429:1..645+ NCBI Rosaceae gene and mRNA sequences
scaffold00563 supercontig scaffold00563:8423..9067- Pyrus communis Genome v1.0 Draft Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>GU991429.1-LFY1 ID=GU991429.1-LFY1|Name=LFY1|organism=Pyrus amygdaliformis|type=gene|length=645bp
tggacgttcatcaataaagaaaaagactcttatactcatatataaaatta
ccacaaagacttggtgattgtctaagaaaaacaattatggggtttttttc
actgtattcacctcattgatgcactttgttgttatggtatgcactagaaa
cttaggtagttgaaccctaagtgttatctacacactcatttttacctctc
acacatcattctcaattcatggttcggatcgaatgaattgaaaatgatca
attgtccaaaattaataagaatgtgttagagataaaaagatgtgtgtgaa
aagcactactaaaagcatttctttccggttatgaaccacacattttaatc
aatttagatttggcaaagtttcacttttgtttatgtattttcaattacat
cgaatttaatacatgcggtccgcaaatttaatcaatttaagaatatccgt
caacttccgtgaatttcttgtatgaaatctgttaaatttatcctcgtaca
agaaatttacattgttgatgaatattctttgaattggaactactttctta
tatcatgagtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggt
cagtttgtagtccaaattaatttgattcaactattgaggccgact
back to top