ACO, AY706156.1-ACO.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameAY706156.1-ACO.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACOACOFragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY706156.1-ACO.m1-cds1AY706156.1-ACO.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACOAY706156.1-ACO.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AY706156 region AY706156:74..1036+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
The following sequences are available for this feature:

mRNA sequence

>AY706156.1-ACO.m1 ID=AY706156.1-ACO.m1|Name=ACO|organism=Fragaria x ananassa|type=mRNA|length=963bp
back to top

protein sequence of ACO

>AY706156.1-ACO.p1 ID=AY706156.1-ACO.p1|Name=ACO|organism=Fragaria x ananassa|type=polypeptide|length=320bp
back to top

mRNA from alignment at AY706156:74..1036+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY706156.1-ACO.m1 ID=AY706156.1-ACO.m1|Name=ACO|organism=Fragaria x ananassa|type=mRNA|length=963bp|location=Sequence derived from alignment at AY706156:74..1036+ (Fragaria x ananassa)
atggagaactttccagtcatcaacatggagaaactcaacggtgaagagag aaacgcaacaatggaaaccatcaaagatgcctgtgagaactggggtttct ttgagctggtgaatcatgggatacccactgtgtttctggacacggtggag aagatgaccaaagaccactacaagaattgtttggagcaaaggtttaagga gccggtggccagcaaaggccttaacgcagttaacactgaggtcaatgaca tggactgggagagcaccttctacctcaaacaccttccccgctccaacatc tcagaagtcccagatctcgacgaagagtacaggaaggtcatgaaggattt cgctctgaaactggagaagctagcagaggagctcttggacttgttctgtg agaatcttggactggaagaagggtacctcaagaaggccttctatggctcc cagggtagtcctacctttggcactaaggtcagcaactaccctccgtgccc caccccggacctcatcaagggtctccggtctcacaccgacgccggcggcg acatccttctgttccaggatgacaaggtcagtggccttcagctcctcaag gatggggaatggattgatgtgcccccaatgcgccactccattgttatcaa ccttggtgaccagcttgaggtgattactaatgggaagtacaagagtgtgg agcacagagtgattgcccagacagatggcaccagaatgtcaatagcttca ttctacaaccctggaagtgatgcagttatctacccggcaccatctttggt ggagacagaaacagaggagaagaatcaagtatacccgaaattcgtgttcg atgactacatgaagctctatgcagtcctcaagttccaggccaaggaaccc agatttgaagccatgaaaacagttgaagccaatcccagtttggctgcaat tgctacagcttaa
back to top

Coding sequence (CDS) from alignment at AY706156:74..1036+

>AY706156.1-ACO.m1 ID=AY706156.1-ACO.m1|Name=ACO|organism=Fragaria x ananassa|type=CDS|length=963bp|location=Sequence derived from alignment at AY706156:74..1036+ (Fragaria x ananassa)
back to top