ANR, DQ664193.1-ANR (gene) Fragaria x ananassa

Gene Overview
NameANR
Unique NameDQ664193.1-ANR
Typegene
OrganismFragaria x ananassa (Strawberry)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRFragaria x ananassagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
ANRDQ664193.1-ANR.m1Fragaria x ananassamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ664193.1
Alignments
Feature NameTypeLocationAnalysis
DQ664193 region DQ664193:1..1684+ NCBI Rosaceae gene and mRNA sequences
LG5 chromosome LG5:66912..68686+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ664193.1-ANR ID=DQ664193.1-ANR|Name=ANR|organism=Fragaria x ananassa|type=gene|length=1684bp
atggccaccacccaacccatcatctcaacaaagtctgcttgtgtcatcgg
cggcaccggcttcgtgacgtctcagctgatcaagctcttgctagagaagg
gctatgccgtcagaaccactgttagagacccaggtcagaactatatcccc
tagcttcttcagacctatattttggttttaccctatttttgcttagcttg
gaaaatggataagtactaggtataaagttttgaaatggatgcataatata
gttgtcagtcttatcacctagaagcttcattatgagctaggtgaggaggg
cattagtgaaatagttgaggatctctaggaacgtactggggttaatctct
ctgtaaaattttagtaatgagagtaaaatttctgagtttagtgtgtatat
taattagctggtgtgaactgtgtattaatgtgtacatttttggcccagat
aatctgaagaagatctcccacctaacagcactacaagagttgggagagct
aacaatatttcgtggggatttaaccgatgaagggagctttgatgctgcta
tagcaggttctgatcttgttttccatgtagccacaccagtccactttggc
tcgccggatccagagaacgacatgatcaagccaggagtccaaggagtact
aaacgttatgaaatcatgtgtgaaagcaaaaacagttaagcgagtcgttt
tgacatcatcagcagctgcagtaactgtcaatactcttagtggaacaggc
ttgatcgccgacgaaaatgattggtctgatgttgagttcttgacaactgc
caagccacctacttgggtaatcaccaaattgtttcagtttcaagagtatt
tgacttgtgtaattgatgctagacaaaaggcctacattgaaataaatgaa
ccaggtgacaaaggttttttttccctcaaatttgcagggatatcctgttt
caaaggtactagctgagaagacagcatggaaatttgctgaagaaaacaac
attgatctcatcactgtgatcccttctctcatggctggtgcttctctcac
tccagatatccccagcagtataggcctcgccacgtctttaattacaggta
tcaaaccatgccacaagctagaatatgttgtccattgctttaacttagtt
acttaaggccttacagcttgaatgaaaagtaatatgcgctgcggccttcc
aatgatcctttttgactctttcaggaaatgagttcctcataaatggcttg
aaaggcatgcaaatgctatcaggttccatatccattacacatgtggagga
tgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtc
ggtacatatgctgtgctgaaaatagtagtgttcctgaggttgcaaagttc
ctcagcaaaagatatcccgactacaaagtcccgactgagtaagttttcta
ttcaaagggaatagccctttaagactatggctgaacttacagaaggcttg
aagtgcatttcattttgttataatccttttgcaatgcaggtttggagatt
ttccatccaaggcgaagaccatactctcttcagaaaagcttaagaaggag
gggttcactttcaagtacgggattgaagacatatatgaccaaactgtgga
gtacttgaaacttaagggggtgctgcagaactag
back to top

gene from alignment at DQ664193:1..1684+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ664193.1-ANR ID=DQ664193.1-ANR|Name=ANR|organism=Fragaria x ananassa|type=gene|length=1684bp|location=Sequence derived from alignment at DQ664193:1..1684+ (Fragaria x ananassa)
atggccaccacccaacccatcatctcaacaaagtctgcttgtgtcatcgg cggcaccggcttcgtgacgtctcagctgatcaagctcttgctagagaagg gctatgccgtcagaaccactgttagagacccaggtcagaactatatcccc tagcttcttcagacctatattttggttttaccctatttttgcttagcttg gaaaatggataagtactaggtataaagttttgaaatggatgcataatata gttgtcagtcttatcacctagaagcttcattatgagctaggtgaggaggg cattagtgaaatagttgaggatctctaggaacgtactggggttaatctct ctgtaaaattttagtaatgagagtaaaatttctgagtttagtgtgtatat taattagctggtgtgaactgtgtattaatgtgtacatttttggcccagat aatctgaagaagatctcccacctaacagcactacaagagttgggagagct aacaatatttcgtggggatttaaccgatgaagggagctttgatgctgcta tagcaggttctgatcttgttttccatgtagccacaccagtccactttggc tcgccggatccagagaacgacatgatcaagccaggagtccaaggagtact aaacgttatgaaatcatgtgtgaaagcaaaaacagttaagcgagtcgttt tgacatcatcagcagctgcagtaactgtcaatactcttagtggaacaggc ttgatcgccgacgaaaatgattggtctgatgttgagttcttgacaactgc caagccacctacttgggtaatcaccaaattgtttcagtttcaagagtatt tgacttgtgtaattgatgctagacaaaaggcctacattgaaataaatgaa ccaggtgacaaaggttttttttccctcaaatttgcagggatatcctgttt caaaggtactagctgagaagacagcatggaaatttgctgaagaaaacaac attgatctcatcactgtgatcccttctctcatggctggtgcttctctcac tccagatatccccagcagtataggcctcgccacgtctttaattacaggta tcaaaccatgccacaagctagaatatgttgtccattgctttaacttagtt acttaaggccttacagcttgaatgaaaagtaatatgcgctgcggccttcc aatgatcctttttgactctttcaggaaatgagttcctcataaatggcttg aaaggcatgcaaatgctatcaggttccatatccattacacatgtggagga tgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtc ggtacatatgctgtgctgaaaatagtagtgttcctgaggttgcaaagttc ctcagcaaaagatatcccgactacaaagtcccgactgagtaagttttcta ttcaaagggaatagccctttaagactatggctgaacttacagaaggcttg aagtgcatttcattttgttataatccttttgcaatgcaggtttggagatt ttccatccaaggcgaagaccatactctcttcagaaaagcttaagaaggag gggttcactttcaagtacgggattgaagacatatatgaccaaactgtgga gtacttgaaacttaagggggtgctgcagaactag
back to top