GLU, U49454.1-GLU.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameU49454.1-GLU.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUU49454.1-GLUPrunus persicagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUGLUPrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
U49454.1-GLU.m1-cds1U49454.1-GLU.m1-cds1Prunus persicaCDS
U49454.1-GLU.m1-cds2U49454.1-GLU.m1-cds2Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GLUU49454.1-GLU.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
PPU49454 region PPU49454:1530..2742+ NCBI Rosaceae gene and mRNA sequences
scaffold_7 supercontig scaffold_7:8592336..8593548- Prunus persica Whole Genome v1.0 Assembly & Annotation
scaffold_7 supercontig scaffold_7:8581255..8582563- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>U49454.1-GLU.m1 ID=U49454.1-GLU.m1|Name=GLU|organism=Prunus persica|type=mRNA|length=1053bp
back to top

protein sequence of GLU

>U49454.1-GLU.p1 ID=U49454.1-GLU.p1|Name=GLU|organism=Prunus persica|type=polypeptide|length=350bp
back to top

mRNA from alignment at PPU49454:1530..2742+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>U49454.1-GLU.m1 ID=U49454.1-GLU.m1|Name=GLU|organism=Prunus persica|type=mRNA|length=1213bp|location=Sequence derived from alignment at PPU49454:1530..2742+ (Prunus persica)
atgactaaatcgaattcgtcatcagttggcagactcctttctctgatttc catagtacttctacttgggcagctggtggtgggtagcttggcaacaaaac aacacacaggtatgcatatataattggcacctctgtcaatctaactgcaa attacgacatttttgtgtgtgtctattttaaagataaggaccaaactgtt ccatgcaacaaaccacgcatttctaatcaatctcacatgtaagcaatatt aattcctttttcaatgtaggtgctccaattggtgtatgtaatggaatggt tggcgatgacctaccaccccaagcagaagttgttgccctctacaagacaa ataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaa ccttcaatacattgccttaagccaagccaacgcaaatgcatgggtccaaa acaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtagga aatgaagtcaagccttcagactcctttgcacagtttctcgtcccagccat gcgaaatattcaagaggcaatttctcttgctggtcttgcaaagaaaatta aagtttcgacagccatcgacaccggagtacttggagagacctttcctcct tcgataggctcattcaagtctgaatataacgcccttttatatcccatcat ccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt attttgcttacagtggcaacactcaagacattcgtcttgactatgctctt ttcacagctccatcagttgtggtacaagatgggaactttggttaccgaaa tcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctg gtggagggtctttgaaagttgttatatcagagactggttggccatcagct gctggaacagccacaacaattgataatgcaaggacttttatatcaaattt gattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatag aaacttacatctttgccatgtttgatgagaatagaaagaccccagagctt gagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat cagtttcaattga
back to top

Coding sequence (CDS) from alignment at PPU49454:1530..2742+

>U49454.1-GLU.m1 ID=U49454.1-GLU.m1|Name=GLU|organism=Prunus persica|type=CDS|length=1053bp|location=Sequence derived from alignment at PPU49454:1530..2742+ (Prunus persica)
back to top