MYB, EU153574.1-MYB.m1 (mRNA) Mespilus germanica

Transcript Overview
Unique NameEU153574.1-MYB.m1
OrganismMespilus germanica ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
MYBMYBMespilus germanicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU153574.1-MYB.m1-cds1EU153574.1-MYB.m1-cds1Mespilus germanicaCDS
EU153574.1-MYB.m1-cds2EU153574.1-MYB.m1-cds2Mespilus germanicaCDS
EU153574.1-MYB.m1-cds3EU153574.1-MYB.m1-cds3Mespilus germanicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MYBEU153574.1-MYB.p1Mespilus germanicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU153574 region EU153574:1..2232+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductR2R3 MYB transcription factor 10
Genbank noteMgMYB10
The following sequences are available for this feature:

mRNA sequence

>EU153574.1-MYB.m1 ID=EU153574.1-MYB.m1|Name=MYB|organism=Mespilus germanica|type=mRNA|length=738bp
back to top

protein sequence of MYB

>EU153574.1-MYB.p1 ID=EU153574.1-MYB.p1|Name=MYB|organism=Mespilus germanica|type=polypeptide|length=245bp
back to top

mRNA from alignment at EU153574:1..2232+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU153574.1-MYB.m1 ID=EU153574.1-MYB.m1|Name=MYB|organism=Mespilus germanica|type=mRNA|length=2232bp|location=Sequence derived from alignment at EU153574:1..2232+ (Mespilus germanica)
atggagggatataacgttaacttgagtgtgagaaaaggtgcctggactcg agaggaagacaatcttctcaggcagtgcattgagattcatggagagggaa agtggaaccaagtttcatacaaagcaggtatatatgttaatgatgtgtat atttaactgtgaaagatgtatatgtgtattattttaaagcatttcactag tatttcattctaagaccttttgttaattagtttcaagttgaatgttttac ttttattagtgttttagaacatgttaatgtgtctaacggccatacctgcc ctcacctcactaatctatggtgtttacatatatggctaaaatgacctttg cgtgtgtgagcagggccatgttgagagacttagtcctttacaagtatgtg ttgttcacgtagaaagatgttatatgaatataaactttgaattatgtatg caggcttaaacaggtgcaggaagagctgcagactaagatggttaaactac ctgaagccaagtatcaagagaggggactttaaagaggatgaagtagatct tataattagacttcacaagcttttaggaaacaggtaccaatatataaatg tctctttcttcgctgtcaacctccacatccacttattttgtccttaatta attgagctcataacacacatggtcatggtgttgccgttggttgaacccta gcccccaaaaacaaaacaaaaatacaaaatacgaacatgtgccagcatat cccgtgcttttttattttattttattttgtctcagaaggacaaaacatgt tggcagcttctcataccctctctgcaaagataaacattaaaattcccgtt gaaatctcattatactttcagctagtcatacaagaaacattacttcggaa atatttaatttttatcattttttaatttcttagtactttggttaatgtat attaagtggagagtttttctatgttacaaagaaaaaaaaaatcatacagt ataattattggggtattaaagcgtggcacaataatattgtctccctaaca ttattgtttcccatacctagcaaaaattaaattaatatatccatccatag gaaatttatttgctctttgttttcttggctgaaattttatacctatgttg ggctccttttccttttactttattcatctttgttattagtaaaatctttc aaacacaaactagcatacaaggagttggctccctttgacatagtttggag ctctaaagaggggaagatgtttggttgcgttgggttcgggtttagccagt acgggactatgggtttggcttagaagatgtggagcggtggtcttatattt ctttattttgttttagactaataattttcaaaaactctttaccagtttgc tgtgatttgttttcttttttaaaaaaaaaaattctttttagcttttggtt tttaatacgaatttgccgtttctaccatttgcacgtcgaatttgtattgt atgtctgagtacatgtgcttctggttgctgaatgggggatttagtcatta tttggattgtgtgtgattctctctagatcaattcaatatgttgttgtgtt tggtcactggagaagatttactcatattcggcacataattgttttgtact tttatttgttcatcaataatatactgtcgcttattttcaacccaaaaaaa aaaaaataataacatacaaatgtattaactttctcatgctatgtgtggaa ggtggtcattgattgctcaaagacttccaggaaggactgcgaatgatgtg aaaaattactggaacacccgattgcggatggattattccctgaaaaagat gaaaaataaatctcaagaaacaagaaagaccaatgtgataagacctcagg cccaaaaattcatcaaaagttcatattacttgagcagtaaagaaccaatt ctggaccatattcaatcagcagaagatttaagtacgccaccacaaacgtc gtcaacaaagaatggaaatgattggtgggagaccttgttagaagtcgatg atacttttgaaagagctgcatgtcccagccttgagttagaggaagaagtc ttcccaagtttttgggttgatgatatgcgactgtcggcaagatcatgtgc caattttcctgaagaaggacaaagtagaagtgaattatcctttagcacgg acctttggaatcattcaaagaagaatagctag
back to top

Coding sequence (CDS) from alignment at EU153574:1..2232+

>EU153574.1-MYB.m1 ID=EU153574.1-MYB.m1|Name=MYB|organism=Mespilus germanica|type=CDS|length=738bp|location=Sequence derived from alignment at EU153574:1..2232+ (Mespilus germanica)
back to top