GLU, AF435089.1-GLU (gene) Prunus persica

Gene Overview
NameGLU
Unique NameAF435089.1-GLU
Typegene
OrganismPrunus persica (Peach)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUGLUPrunus persicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GLUAF435089.1-GLU.m1Prunus persicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF435089.1
Alignments
Feature NameTypeLocationAnalysis
AF435089 region AF435089:1473..3181+ NCBI Rosaceae gene and mRNA sequences
scaffold_7 supercontig scaffold_7:8584001..8585698- Prunus persica Whole Genome v1.0 Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF435089.1-GLU ID=AF435089.1-GLU|Name=GLU|organism=Prunus persica|type=gene|length=1709bp
atggctaaatccaattcgtcagtcggtagaggcccttcaatgatttcgat
agtatttctacttgggctgctgatggctagctttgaaacaacaggtatat
atctctggcaagattcgtccctattttggcttggaaggctacatagtttt
gatattcttacaaactttgaggctattaagggctaaaagggccgagctcg
tatttgacaattatttatttatttttttactatagatctgtgggaactgt
tgcctgatacttttcttttacacaattacttgatttttccaacgaacttc
tgtgttgcttccatgtctgggtcagggtggatggaaacaatgtgcaaaac
agaatttaatagcttctacttaaacttcattttcatgtgcaaggttattg
ataagcgggggaagggaagaatgctgttgggttttactttttttcaattg
aaaaattatttattatttattttgtccacgtgtgtacgaaattacaaaaa
cacccatgtcacgtagtcaaaattaacaaatttttggacggagttgatgt
tggggggcaaacaaggccaccaaaatacggtcaagcggggtaagtgagcc
actttgaatttcagagagcagtgtgagatttgaccgtagtttcaagggac
attggtgtaaataggccttgaatatattcatgatcattttagcaacaaat
tatattgtataaatctagtgaacttttcaccaggatcataaaacctcatt
ataatttcttcaatattgcaggagcccagattggtgtatgttatggaatg
cttggagatcgtttaccacccccatcagaagttattgctctgtataagca
aaataacatcagaaggatgcgactgtatgatccaaaccaggctgctctag
cagcccttaaaggctcttatattgagctcatgctaggcgttccaaatgac
aaccttcaaagcctagcctcaagccaggccaatgcaaatacttgggtcca
aaacaatgtgagaaactatggcaatgtaagattcaaatacattgcggtag
gaaatgaagtcaagccctcagactcctatgcacaatttcttgtcccggcc
atgcaaaacattcagaacgcaatttctagtgctggtttgggaattaaagt
ctccactgccgtagacactggagtgcttggaaattcctttcctccatcga
agggagagttcaagtccgaatatggagcacttttgaaccccatcatccgc
ttcctagtgaacaacagatcgccgttgctggttaatttgtacccgtattt
cagctacagcagcaacactcacgacattcgtctagattatgctcttttca
cagctccatcagttgtggtacaagatggccaacgtggctatcgtaatctt
ttcgatgccattttggacgctgtttatgccgctcttgagaaggcgggcgg
agggtctttggaaattgtcatatccgaaagtggttggccatcagctggtg
gaacggcaacaacaattgataatgcaaggacttataatgcaaatctgatt
caacatgtgaagggagggactccaaggaagcccggaagggccatagaaac
ctacatctttgccatgtttgatgagaacagaaagaacccagagttggaga
aacattgggggctgttttcaccaagcaaacagccgaaatacccaatcaat
ttcaactga
back to top

gene from alignment at AF435089:1473..3181+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF435089.1-GLU ID=AF435089.1-GLU|Name=GLU|organism=Prunus persica|type=gene|length=1709bp|location=Sequence derived from alignment at AF435089:1473..3181+ (Prunus persica)
atggctaaatccaattcgtcagtcggtagaggcccttcaatgatttcgat agtatttctacttgggctgctgatggctagctttgaaacaacaggtatat atctctggcaagattcgtccctattttggcttggaaggctacatagtttt gatattcttacaaactttgaggctattaagggctaaaagggccgagctcg tatttgacaattatttatttatttttttactatagatctgtgggaactgt tgcctgatacttttcttttacacaattacttgatttttccaacgaacttc tgtgttgcttccatgtctgggtcagggtggatggaaacaatgtgcaaaac agaatttaatagcttctacttaaacttcattttcatgtgcaaggttattg ataagcgggggaagggaagaatgctgttgggttttactttttttcaattg aaaaattatttattatttattttgtccacgtgtgtacgaaattacaaaaa cacccatgtcacgtagtcaaaattaacaaatttttggacggagttgatgt tggggggcaaacaaggccaccaaaatacggtcaagcggggtaagtgagcc actttgaatttcagagagcagtgtgagatttgaccgtagtttcaagggac attggtgtaaataggccttgaatatattcatgatcattttagcaacaaat tatattgtataaatctagtgaacttttcaccaggatcataaaacctcatt ataatttcttcaatattgcaggagcccagattggtgtatgttatggaatg cttggagatcgtttaccacccccatcagaagttattgctctgtataagca aaataacatcagaaggatgcgactgtatgatccaaaccaggctgctctag cagcccttaaaggctcttatattgagctcatgctaggcgttccaaatgac aaccttcaaagcctagcctcaagccaggccaatgcaaatacttgggtcca aaacaatgtgagaaactatggcaatgtaagattcaaatacattgcggtag gaaatgaagtcaagccctcagactcctatgcacaatttcttgtcccggcc atgcaaaacattcagaacgcaatttctagtgctggtttgggaattaaagt ctccactgccgtagacactggagtgcttggaaattcctttcctccatcga agggagagttcaagtccgaatatggagcacttttgaaccccatcatccgc ttcctagtgaacaacagatcgccgttgctggttaatttgtacccgtattt cagctacagcagcaacactcacgacattcgtctagattatgctcttttca cagctccatcagttgtggtacaagatggccaacgtggctatcgtaatctt ttcgatgccattttggacgctgtttatgccgctcttgagaaggcgggcgg agggtctttggaaattgtcatatccgaaagtggttggccatcagctggtg gaacggcaacaacaattgataatgcaaggacttataatgcaaatctgatt caacatgtgaagggagggactccaaggaagcccggaagggccatagaaac ctacatctttgccatgtttgatgagaacagaaagaacccagagttggaga aacattgggggctgttttcaccaagcaaacagccgaaatacccaatcaat ttcaactga
back to top