GLU, AF435088.1-GLU (gene) Prunus persica

Gene Overview
NameGLU
Unique NameAF435088.1-GLU
Typegene
OrganismPrunus persica (Peach)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUGLUPrunus persicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GLUAF435088.1-GLU.m1Prunus persicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF435088.1
Alignments
Feature NameTypeLocationAnalysis
AF435088 region AF435088:1204..2512+ NCBI Rosaceae gene and mRNA sequences
scaffold_7 supercontig scaffold_7:8581255..8582563- Prunus persica Whole Genome v1.0 Assembly & Annotation
scaffold_7 supercontig scaffold_7:8592336..8593548- Prunus persica Whole Genome v1.0 Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF435088.1-GLU ID=AF435088.1-GLU|Name=GLU|organism=Prunus persica|type=gene|length=1309bp
atgactaaatcgaattcgtcatcagttggcagatgcctttctctgatttc
tatagtacttctacttgggcagctggtggtggctagcttggcaacaaaac
aacacacaggtatgcatatataattggcactgctgtctgtcaatctaact
gccaatttagcttttgtttttctagcgtatgattcatctaactcgtgatt
aacgaaagccaatgcacaacaaataacgacatttttgtgtgtgtctattt
ttaaaacataaggaccaaactgttccatgcaacaaaccacgcattcctaa
tcaatctcacataaggaccaaattggtgtgtctatttagcaatataaatt
cctttttcaatgtaggtgctccagttggtgtatgtaatggaatggttggc
gatgacctaccaccccaagcggaagttgttgccctctacaagacaaataa
catcccaagaatgcgactttatgatccaaacccagccgctctagaagccc
ttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaacctt
caatacattgccttaagccaagccaacgcaaatgcatgggtccaaaacaa
tgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatg
aagtcaagccttcagactcctttgcacagtttctcgtcccagccatgcga
aatattcaagaggcaatttctcttgctggtcttgcaaagaaaattaaagt
ttcgacagccatcgacaccggagtacttggagagacctttcctccttcga
taggctcattcaagtctgaatataacgcccttttatatcccatcatccgc
ttcctagtgagccaccaatcgccattgcttgttaacttgtacccttattt
tgcttacagtggcaacactcaagacattcgtcttgactatgctcttttca
cagctccatcagttgtggtacaagatgggaactttggttaccgaaatctt
ttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtgg
agggtctttgaaagttgttatatcagagactggttggccatcagctgctg
gaacagccacaacaattgataatgcaaggacttttatatcaaatttgatt
caacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaac
ttacatctttgccatgtttgatgagaatagaaagacccccgagcttgaga
aacattgggggctcttctccccaacaaaacagcctaaataccaaatcagt
ttcaattga
back to top

gene from alignment at AF435088:1204..2512+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF435088.1-GLU ID=AF435088.1-GLU|Name=GLU|organism=Prunus persica|type=gene|length=1309bp|location=Sequence derived from alignment at AF435088:1204..2512+ (Prunus persica)
atgactaaatcgaattcgtcatcagttggcagatgcctttctctgatttc tatagtacttctacttgggcagctggtggtggctagcttggcaacaaaac aacacacaggtatgcatatataattggcactgctgtctgtcaatctaact gccaatttagcttttgtttttctagcgtatgattcatctaactcgtgatt aacgaaagccaatgcacaacaaataacgacatttttgtgtgtgtctattt ttaaaacataaggaccaaactgttccatgcaacaaaccacgcattcctaa tcaatctcacataaggaccaaattggtgtgtctatttagcaatataaatt cctttttcaatgtaggtgctccagttggtgtatgtaatggaatggttggc gatgacctaccaccccaagcggaagttgttgccctctacaagacaaataa catcccaagaatgcgactttatgatccaaacccagccgctctagaagccc ttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaacctt caatacattgccttaagccaagccaacgcaaatgcatgggtccaaaacaa tgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatg aagtcaagccttcagactcctttgcacagtttctcgtcccagccatgcga aatattcaagaggcaatttctcttgctggtcttgcaaagaaaattaaagt ttcgacagccatcgacaccggagtacttggagagacctttcctccttcga taggctcattcaagtctgaatataacgcccttttatatcccatcatccgc ttcctagtgagccaccaatcgccattgcttgttaacttgtacccttattt tgcttacagtggcaacactcaagacattcgtcttgactatgctcttttca cagctccatcagttgtggtacaagatgggaactttggttaccgaaatctt ttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtgg agggtctttgaaagttgttatatcagagactggttggccatcagctgctg gaacagccacaacaattgataatgcaaggacttttatatcaaatttgatt caacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaac ttacatctttgccatgtttgatgagaatagaaagacccccgagcttgaga aacattgggggctcttctccccaacaaaacagcctaaataccaaatcagt ttcaattga
back to top