GAPDH2, AF421493.1-GAPDH2 (gene) Fragaria x ananassa

Gene Overview
NameGAPDH2
Unique NameAF421493.1-GAPDH2
Typegene
OrganismFragaria x ananassa (Strawberry)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDH2GAPDH2Fragaria x ananassagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDH2AF421493.1-GAPDH2.m1Fragaria x ananassamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF421493.1
Alignments
Feature NameTypeLocationAnalysis
AF421493 region AF421493:1..845+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF421493.1-GAPDH2 ID=AF421493.1-GAPDH2|Name=GAPDH2|organism=Fragaria x ananassa|type=gene|length=845bp
tccatcactggtgagttttcacttgtgacttgagatatatgaatgttgag
atgctatatataaatctaatggaagttgattgtgtctttgtaattcagcc
acccagaagactgttgatggaccatcagccaaggactggagaggtggacg
tgctgcctcattcaacatcattcctagcagcactggagctgccaaggtat
gttatgttctctggtgttgctgctagtttcagtatcacagatacatttcc
aagtgatatttcattgttagctgctttattaatccgattcctgtttgatt
gtcatgttcaggctgtcggaaaggttctgcctgctctcaatggcaagttg
actggaatggccttccgtgtacccactgttgatgtttcagttgttgacct
cactgtcagacttgagaagaaggccacctatgaccagatcaaggctgcta
tcaagtaaggctcggaaaagtttgtcggctaaataagttgcaatcaagat
gatataatgaatggtataatgcatgtcttgtttcccatgtttatgtctac
tctgtctcaacagggaggggtctgagggaaagatgaagggtatcttgggt
tacaccgaagatgatgttgtgtcaaccgacttcattggtgacaacaggta
aattctattctgtttgggatttgactcaacaagttaaagccagagaacaa
tctgtcatgtttggacggtgattatctatattgtagttgtgtaatatcgg
ctttatctaattcaatatctggttctctcaggtcaagcatctttgatgcc
aaggctggaattgcattgaacgagaactttgtcaaggttgtgtca
back to top

gene from alignment at AF421493:1..845+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF421493.1-GAPDH2 ID=AF421493.1-GAPDH2|Name=GAPDH2|organism=Fragaria x ananassa|type=gene|length=845bp|location=Sequence derived from alignment at AF421493:1..845+ (Fragaria x ananassa)
tccatcactggtgagttttcacttgtgacttgagatatatgaatgttgag atgctatatataaatctaatggaagttgattgtgtctttgtaattcagcc acccagaagactgttgatggaccatcagccaaggactggagaggtggacg tgctgcctcattcaacatcattcctagcagcactggagctgccaaggtat gttatgttctctggtgttgctgctagtttcagtatcacagatacatttcc aagtgatatttcattgttagctgctttattaatccgattcctgtttgatt gtcatgttcaggctgtcggaaaggttctgcctgctctcaatggcaagttg actggaatggccttccgtgtacccactgttgatgtttcagttgttgacct cactgtcagacttgagaagaaggccacctatgaccagatcaaggctgcta tcaagtaaggctcggaaaagtttgtcggctaaataagttgcaatcaagat gatataatgaatggtataatgcatgtcttgtttcccatgtttatgtctac tctgtctcaacagggaggggtctgagggaaagatgaagggtatcttgggt tacaccgaagatgatgttgtgtcaaccgacttcattggtgacaacaggta aattctattctgtttgggatttgactcaacaagttaaagccagagaacaa tctgtcatgtttggacggtgattatctatattgtagttgtgtaatatcgg ctttatctaattcaatatctggttctctcaggtcaagcatctttgatgcc aaggctggaattgcattgaacgagaactttgtcaaggttgtgtca
back to top