LFY, EU683936.1-LFY (gene) Crataegus nigra

Gene Overview
NameLFY
Unique NameEU683936.1-LFY
Typegene
OrganismCrataegus nigra ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus nigragene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU683936.1-LFY.m1Crataegus nigramRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU683936.1
Alignments
Feature NameTypeLocationAnalysis
EU683936 region EU683936:1..1038+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU683936.1-LFY ID=EU683936.1-LFY|Name=LFY|organism=Crataegus nigra|type=gene|length=1038bp
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggtta
tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt
tccaggcttatggggttagatactacacgacggcgaagatagcggagctt
ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga
catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg
agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag
gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa
tgccctagatgctctctcccaacaaggtactatgaatattatttaccctt
gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattac
actttgaaataacattatttacatgtaaattaatagtgcgacaaaataac
atgttcaaacagatgataaaaaagaattagaatttagtgaatcaaagaag
aaaaatagttcgcaaaacattaaaacttttggcctttggtgtaataattt
gatggaaataacaaatcaaagatgtttattattctgtgacatactatgcc
agatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttt
atatgattgtaacataatatgtcaattatcgtagtctttgatactagaac
ataaagttgttgttatattagattgggatatatgacacgctgtgcatggg
atgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcgg
aagaagcagcggagggtgaagaaggggcaatataggaactgtagtgctgg
agggggtcataataatgatcataacgagggtgtagacgacaaggacgacg
acatggacgacatgaatgggcaggggaacggtggagga
back to top

gene from alignment at EU683936:1..1038+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU683936.1-LFY ID=EU683936.1-LFY|Name=LFY|organism=Crataegus nigra|type=gene|length=1038bp|location=Sequence derived from alignment at EU683936:1..1038+ (Crataegus nigra)
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt tccaggcttatggggttagatactacacgacggcgaagatagcggagctt ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa tgccctagatgctctctcccaacaaggtactatgaatattatttaccctt gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattac actttgaaataacattatttacatgtaaattaatagtgcgacaaaataac atgttcaaacagatgataaaaaagaattagaatttagtgaatcaaagaag aaaaatagttcgcaaaacattaaaacttttggcctttggtgtaataattt gatggaaataacaaatcaaagatgtttattattctgtgacatactatgcc agatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttt atatgattgtaacataatatgtcaattatcgtagtctttgatactagaac ataaagttgttgttatattagattgggatatatgacacgctgtgcatggg atgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtgg ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcgg aagaagcagcggagggtgaagaaggggcaatataggaactgtagtgctgg agggggtcataataatgatcataacgagggtgtagacgacaaggacgacg acatggacgacatgaatgggcaggggaacggtggagga
back to top