LFY, EU683952.1-LFY (gene) Crataegus phaenopyrum

Gene Overview
NameLFY
Unique NameEU683952.1-LFY
Typegene
OrganismCrataegus phaenopyrum ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus phaenopyrumgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU683952.1-LFY.m1Crataegus phaenopyrummRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU683952.1
Alignments
Feature NameTypeLocationAnalysis
EU683952 region EU683952:1..441+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU683952.1-LFY ID=EU683952.1-LFY|Name=LFY|organism=Crataegus phaenopyrum|type=gene|length=441bp
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat
tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca
gaacattgccaaggagcggggtgaaaaatgtcccaccaaggtacgaagtt
ttacccatctcccctctttacgtacgctgatttctactgtggccattaat
taacagtaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgta
ccgcatacataacgatctggtacaaggtattaacggaagttgaggtttag
ggatgtcctggagttggaacaaaatgyataatttcgttttgcatttgttt
actctttacattatatatgcaggtgacaaaccaagtktttaggtatgcca
aaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top

gene from alignment at EU683952:1..441+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU683952.1-LFY ID=EU683952.1-LFY|Name=LFY|organism=Crataegus phaenopyrum|type=gene|length=441bp|location=Sequence derived from alignment at EU683952:1..441+ (Crataegus phaenopyrum)
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcggggtgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatttctactgtggccattaat taacagtaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgta ccgcatacataacgatctggtacaaggtattaacggaagttgaggtttag ggatgtcctggagttggaacaaaatgyataatttcgttttgcatttgttt actctttacattatatatgcaggtgacaaaccaagtktttaggtatgcca aaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top