LFY, EU500544.1-LFY (gene) Crataegus meyeri

Gene Overview
NameLFY
Unique NameEU500544.1-LFY
Typegene
OrganismCrataegus meyeri ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus meyerigene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500544.1-LFY.m1Crataegus meyerimRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500544.1
Alignments
Feature NameTypeLocationAnalysis
EU500544 region EU500544:1..618+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500544.1-LFY ID=EU500544.1-LFY|Name=LFY|organism=Crataegus meyeri|type=gene|length=618bp
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat
tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca
gaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagtt
ttacccatctcccctctttacgtacgctgatttctactgtggcaattaat
taacagtaaaaattctaatgttagtcattgaaatcaacacaaatattaaa
tggtcgcgtttgtaatggttttagttctatagtttccacatagttatagt
ttcgttcatgtattgcaagtcgcatcgacataactcccgacaatttgcaa
attgctgtaattcgaaggcacccgtcaaattttgttgaattcttgtatga
agtccgtcaaatttaccatttcgtgtaccacatacataacgatctggtac
aaggtattaacggaagttgaggtttagggatgtcctcgagttggaacaaa
acgtataatttcgttttgcatttgtttactctttacattatatatgcagg
tgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc
aacaagcccaagatgcgc
back to top

gene from alignment at EU500544:1..618+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500544.1-LFY ID=EU500544.1-LFY|Name=LFY|organism=Crataegus meyeri|type=gene|length=618bp|location=Sequence derived from alignment at EU500544:1..618+ (Crataegus meyeri)
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatttctactgtggcaattaat taacagtaaaaattctaatgttagtcattgaaatcaacacaaatattaaa tggtcgcgtttgtaatggttttagttctatagtttccacatagttatagt ttcgttcatgtattgcaagtcgcatcgacataactcccgacaatttgcaa attgctgtaattcgaaggcacccgtcaaattttgttgaattcttgtatga agtccgtcaaatttaccatttcgtgtaccacatacataacgatctggtac aaggtattaacggaagttgaggtttagggatgtcctcgagttggaacaaa acgtataatttcgttttgcatttgtttactctttacattatatatgcagg tgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc aacaagcccaagatgcgc
back to top