LFY, EU500530.1-LFY (gene) Crataegus flabellata

Gene Overview
Unique NameEU500530.1-LFY
OrganismCrataegus flabellata ()
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus flabellatagene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500530.1-LFY.m1Crataegus flabellatamRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
EU500530 region EU500530:1..417+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>EU500530.1-LFY ID=EU500530.1-LFY|Name=LFY|organism=Crataegus flabellata|type=gene|length=417bp
back to top

gene from alignment at EU500530:1..417+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500530.1-LFY ID=EU500530.1-LFY|Name=LFY|organism=Crataegus flabellata|type=gene|length=417bp|location=Sequence derived from alignment at EU500530:1..417+ (Crataegus flabellata)
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatttctactgtggccattaat taacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgtgta ccacatacataacgatctggtacaaggtattaacggaagttggaacaaaa tgtataatttcgttttgcatttgtttgctctttacattatatatgcaggt gacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca acaagcccaaaatgcgc
back to top