LFY, EU500527.1-LFY (gene) Crataegus submollis

Gene Overview
NameLFY
Unique NameEU500527.1-LFY
Typegene
OrganismCrataegus submollis ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus submollisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500527.1-LFY.m1Crataegus submollismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500527.1
Alignments
Feature NameTypeLocationAnalysis
EU500527 region EU500527:1..420+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500527.1-LFY ID=EU500527.1-LFY|Name=LFY|organism=Crataegus submollis|type=gene|length=420bp
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat
tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca
gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt
ttacccatctcccctctttacgtacgctgatgatttctactgtggcaatt
aattaacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgt
gtaccacatacataacgatctggtacaaggtattaacggaagttggaaca
aaatgtataatttcgttttgcatttgtttgctctttacattatatatgca
ggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctaca
tcaacaaacccaaaatgcgc
back to top

gene from alignment at EU500527:1..420+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500527.1-LFY ID=EU500527.1-LFY|Name=LFY|organism=Crataegus submollis|type=gene|length=420bp|location=Sequence derived from alignment at EU500527:1..420+ (Crataegus submollis)
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatgatttctactgtggcaatt aattaacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgt gtaccacatacataacgatctggtacaaggtattaacggaagttggaaca aaatgtataatttcgttttgcatttgtttgctctttacattatatatgca ggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctaca tcaacaaacccaaaatgcgc
back to top