LFY, EU500526.1-LFY (gene) Crataegus ashei

Gene Overview
NameLFY
Unique NameEU500526.1-LFY
Typegene
OrganismCrataegus ashei ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus asheigene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500526.1-LFY.m1Crataegus asheimRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500526.1
Alignments
Feature NameTypeLocationAnalysis
EU500526 region EU500526:1..417+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500526.1-LFY ID=EU500526.1-LFY|Name=LFY|organism=Crataegus ashei|type=gene|length=417bp
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgat
tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca
gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt
ttacccatctcccctctttacgtacgctgatttctactgtggcaattaat
taacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgtgta
ccacatacataacgatctggtacaaggtattaacggaagttggaacaaaa
tgtataatttcgttttgcatttgtttgctctttacattatatatgcaggt
gacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca
acaaacccaaaatgagc
back to top

gene from alignment at EU500526:1..417+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500526.1-LFY ID=EU500526.1-LFY|Name=LFY|organism=Crataegus ashei|type=gene|length=417bp|location=Sequence derived from alignment at EU500526:1..417+ (Crataegus ashei)
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatttctactgtggcaattaat taacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgtgta ccacatacataacgatctggtacaaggtattaacggaagttggaacaaaa tgtataatttcgttttgcatttgtttgctctttacattatatatgcaggt gacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca acaaacccaaaatgagc
back to top